| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAAUCAUUGCACUCCCUACUAGAGCGGAUGUGAUGAGGGAAAAGGAGAA… | 1351 nt | 0.4848 |
This gene encodes a secreted fibroblast growth factor carrier protein. The encoded protein plays a critical role in cell proliferation, differentiation and migration by binding to fibroblast growth factors and potentiating their biological effects on target cells. The encoded protein may also play a role in tumor growth as an angiogenic switch molecule, and expression of this gene has been associated with several types of cancer including pancreatic and colorectal adenocarcinoma. A pseudogene of this gene is also located on the short arm of chromosome 4. [provided by RefSeq, Nov 2011]
A study in human skin wound healing demonstrated that the FGFBP1 is expressed in migrating basal keratinocytes (Bas-mig) [Liu et al. DOI:10.1016/j.stem.2024.11.013].