| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAUAGCGCUCGGAGCGCUCUUGCGGCCACAGGCGCGGCGUCCUCGGCG… | 5691 nt | 0.5586 | |
| GCAUAGCGCUCGGAGCGCUCUUGCGGCCACAGGCGCGGCGUCCUCGGCG… | 5430 nt | 0.5540 | |
| GCAUAGCGCUCGGAGCGCUCUUGCGGCCACAGGCGCGGCGUCCUCGGCG… | 5424 nt | 0.5540 | |
| GCAUAGCGCUCGGAGCGCUCUUGCGGCCACAGGCGCGGCGUCCUCGGCG… | 5697 nt | 0.5585 |
The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. Mutations in this gene have been associated with Pfeiffer syndrome, Jackson-Weiss syndrome, Antley-Bixler syndrome, osteoglophonic dysplasia, and autosomal dominant Kallmann syndrome 2. Chromosomal aberrations involving this gene are associated with stem cell myeloproliferative disorder and stem cell leukemia lymphoma syndrome. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008] CIViC Summary for FGFR1 Gene FGFR1 is a member of the Fibroblast Growth Factor family, comprising of 4 receptors and 18 Ligands. FGFR1 signalling downstream functions mainly via PI3K and MAPK pathways (Turner et. al.). Several ways of involvement of FGFR1 in cancer have been proposed: auto- and paracrine activation, amplification and overexpression (Marshall et. al, Weiss et. al., Cheng et. al.). Especially amplification of FGFR1 in lung cancer is an emerging treatment target with clinical studies currently ongoing (e.g. NCT01004224). However, FGFR1 amplification does not always correlate with protein expression and predictive biomarkers still remain to be defined in clinic (von M?ssenhausen et. al.). Mutation of FGFR1 seems to be less common, but has been described in glioblastoma, pilocytic astrocytomas and Ewing's sarcoma (Rand et. al., Jones et. al., Agelopoulos et. al.).
A study in mice demonstrated that chronic alcohol exposure increases HDAC levels, leading to H4 hypoacetylation and inhibition of gene expression in the nucleus accumbens [Hediyal et al. DOI:10.3390/Brainsci15090927]. Research in rats and mice shows that acute or repeated exposure to cocaine or other stimulants increases global levels of histone H4 acetylation in the nucleus accumbens, a modification associated with gene activation [Nestler DOI:10.1016/J.Neuropharm.2013.04.004]. A study in rats demonstrated that blast-induced mild traumatic brain injury triggers a complex vascular repair response, with the FGFR1 showing elevated mRNA expression at all time points following higher intensity (10-11 psi and 14-15 psi) exposures, correlating with fibroblast proliferation pathways involved in wound healing [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001].