Basic Information

Symbol
FGFR2
RNA class
mRNA
Alias
Fibroblast Growth Factor Receptor 2 Keratinocyte Growth Factor Receptor K-SAM CD332 CEK3 TK14 TK25 ECT1 KGFR BEK Bacteria-Expressed Kinase EC 2.7.10.1 CFD1 JWS Protein Tyrosine Kinase, Receptor Like 14 BEK Fibroblast Growth Factor Receptor Craniofacial Dysostosis 1 Jackson-Weiss Syndrome Pfeiffer Syndrome Crouzon Syndrome CD332 Antigen EC 2.7.10 FGFR-2 BFR-1 K-Sam BBDS KSAM
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_000141.5
Sequence length
4624.0 nt
GC content
0.4896

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1529.70 kcal/mol
Thermodynamic ensemble
Free energy: -1610.45 kcal/mol
Frequency: 0.0000
Diversity: 1197.80
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((.(((.(((..(((((.(.((((((((((.((((((((((.(((.(((......))).)))..))).)))....((((((..((.(((((((...((((((...(((.(((.(((.(((.((....)).))).)))))).)))....))))))))))))).))..)))))).)))).)))))))))).))))))..)))..)))..)))((((.....(((((((((((((...(((((.((((.((((..(((((((((((((.(((........))).))).(((((((.....))))))).(((((.((.((.((((.(((((((((.(((.(((...(((.((....)).))).))).((((((..(((((((((((((..((((.(((((((..(((((.(...((((............))))...).))))).))))))))))).)))).)))))))))((((((((........(.((((....)))))))))))))...)).)))).((((.......))))...))).))))))))).)))).))..)).))))).(((((..((((.......))))))))).))))...))))))))))))))..)))))......((((.((((((..((((((.((((.((((..(((.(((.(((.(((.(((((((((.((((.(((...((((....((((((((((((((((............(((((...(((((((.............((((.(((((.((.(((((((((((((.(......).)))))).....)))))))..))))))).))))....(((........))).....(.((((...(((.(((((.(((.........(((((.((((((((..(((((..(((......(((((...)))))((((.(....).)))).)))..))))).)))))))))))))...((((((((((((.......((((((...(((.(((...(((((((((((...........)))))......(((((((........((((.(.((....)).).)))).......))))))).(((........)))...))))))....(((((.....)))))..))).)))...))))))))))))))))))(((....))))))..))))))))...)))).))))))))......((((..((((((((.(.((((((..(((..(((((((.....((((((..((((.((((....((.......))..))))))))(((.........))).......((((((((.((.....))..))))))))............))))))............(((((.(((.(((.....)))..)))))))).(((((....)))))....)))))))..)))(((......)))(((((.((((....)))).)))))......((.(((((((((.....)))).....((.(((........))))).........((((((....))..)))).(((((((...((((...((((..((((....)))).))).)...)))))))))))........(((((((......)))))))..(((.((((...((((((((((((((((((.(((....))).)))))............((((((...(((((.((((...))))...................(((((.((((.....)))).)).)))(((((...(((((((((.((.....((((((.....))))))...)).).)))))))).))))).))))).)))))).((((.....)))).((((((....)))))))).))))).......)))))).)))).)))(((((........)))))))))).))...)))))).).)))))))).....)))))))))((((...........))))))))))))((.((((.((((((...)))..)))))))))......(((((((((............)))))))))........))))))))....))))..)))...)))).))))))))).)))......((((((((.((..((..((((..(((.......))).)))).....))..)).))))))))...............))).)))))))))))))))))))).))))))))))(((((((((((((((.((((..((..(((.......)))..)).))))..)))(((((((((((((....))))......(((.((((...))))..)))..(((((....)))))..)))))))))..((((((....))))))...((((((((((((((.(((((.(((((((...((((..((.(((((((((.(.(((...)))....(((((...)))))..(((((((.(((((((...(((((((.((((((.(((....(((.(((.((....(((((((((......((((((.((.(((........))).)).)))))).....((((((.....)))))).......................((((((.((......(((((((((((....(((((((.((((((....((((((...((((((.(((.(((((....))))))))))).)))...)))))).........)))).)))))))))..)))))).)))))...(((.((....)).))).))..))))))..))))))))).)).))).)))...)))..))))))(((((((((...((((....((...((.....((((((((((......))))).))))).))...))...))))...)))))))))(((((((..((((((...((((...((((.......))))((((((((((.......)))...........)))))))...........((((.((((((...))))))...)))))))))))))).)))))))..........((((((....(((..((((((((((................(((((((((((.(((((((((((((((((.((((((((........(((((((((.(((.((..((((((....(((.((((((((((......((((...(((((..((((.((.((........)).)).))))..)))))))))..((((..(((((...(((((((....))))))))))))..))))....(((((.((....)).)))))...(((((((.(((..((((..((((((..((....(((((.(((..(((((...((.(.((((((.......)))))).)))...)))))((((((...(((..((((.((((((......))))))..)))).)))..))))))(((((.....(((...(((....))).))).....)))))((((((((....))))))))..........(((((((((...)))))))))..))).)))))....))..)))........)))..))))...)))..)))))))..)))))))))).)))....)))))).)).)))..)))))))))................((((((.(((((((((((((......)))))))))))...)))))))).(((((...((((((((....))))))))...)))))...........(((((((.((((........))))))))))).........)))))))))))))..((((((((((((((.....)))).)))))))))).(((..(((((.....((...((((.......))))..)).....)))))...))).........)))))))))))).))))))))))).........((((((.........................))))))........))))))))))))).....)))))).....((((.((((..(((((.....((((..(((((((.............))).)))).((((((......(((......)))........))))))))))....)))))..)))).))))...))))))))))))))))))))).).))))))))).))..))))......((((.((((((((......((((((......((((...(((((..(((.(((..((((((...))))))....))).)))..)))))..))))......))))))..)))).)))).)))).)))).))).))))).))).)))))))).....)))......))))))....)))))).(((.((.......)).))).))))).......))))))))......)))).(((((....((((((((((((((........))))))))..........(((.((((((.......)))))).))).))))))..((((.........))))......((((((.......))))))......(((((((.((.(((((((((.......))).....))).))).)).))))))).((((.......))))..)))))............
Thermodynamic Ensemble Prediction
..,.((({(((..(((((,(.((((((((((.((((((((((.(((.(((......))).)))..)))},))....((((((,.((.(((((((...((((((,..(((.(((((((.(((.((....)).))).)))))).)))..,.))))))))))))).))}})))))).)))).)))))))))).))))))..})).((((.....))))|{,,,(({{(((({{{{{..,|||||))||{,({,{,,{(((((((({(((.(((......,.))).})).{((((((,...,))))))),{((((.{(.((,(({(,({{(((({({(((,{{..|||||{||||,(({..,{.,{,.,{{....{(((((((((((((..((((.(((((((..(((((.(...((((............))))...).))))).))))))))))).)))).)))))))))|(((((((........|.((((....))))}))))))))}},))},})),})))..)),,,)))),..}}}.}})))))}}.)))),)),,)).))))),},(((((((,((((.,{(({||{,,||,}}||,.{|||,(((({,.,(({..((((..(((,..,.{((((((((((((((.((((.((((..(((.(((.(((.(((.(((((((((.((((.(((...((((....(((((((({(((((((............(((((...(((((((.............((((.(((({,((.(((((((((((((.(......).)))))).....)))))))..})))))).)))).{{{{({......,,})).,...{.{(((.,.(((.(((((.(((.........(((((.((((((((,.(((((..(((......{((((...))))|((((.(....).)))),)))..))))).)))))))))))))...(((((((((((({......,(((((...(((,({{...,(((((((((,......},,,,)))))...,,.(((((((......,,((((.{.((....)}.}.))}),,,,,..))))))).{((........)}}....}||||,...{{{{{,}}},}))))}.}}}.)))...}}})))))))))))))))(((....))))))..)))))))),..)))).))))))))......((((..((((((((.(.((((((.,{{({{{,((((({.{{,(((,,,...{{.}|{||,.,}||}}.....}}..}})}}}}|(((,........||},.....,||||{|||,||||,,|,,.....|{{{|{{........,,,{,.(((,,(((((({.{(((((.(((.(((.....)))..)))))))}.(((((....)))))....,(({{{{{...,)).)))))|,{{(({((.,,||}}}|},,|{||,,}.,,,,,}}},,}},||))))))))))).....((.(((........))))).,,......}}}}})}..{|||||||,.{((((((...((((...{(((..((((....)))).))).}...))))))))))}|||||,,.,{{{{{|......}}))))}},(((.((((...{((((({((((((({({,.{((,..,|}|||,|||(((,,{(({{(,((({{({,.,,||{}||||,,,,}}}.}}}}.,|||||,,|,.,.(((((.((((.....)))).)).))){{{{{...((((((({|.||,,||.{(((((.....)))))),}.}).}.}))))))).))})),}}.,,.,,.}},.|{{{.,,,.}}}}.((((((....))))))}}.})))),,.....)))))),)))).)))(((((.{....}.)))))})),,,}}}}.)))))).).)))))))).....)))))))))((((...........))))))))))})((.((((.((((({...)))..))))))))),.,...{{(((((((.......,....)))))))})},......))))))))....))))..)))...)))).))))))))).))).....{((((((((.((..((..((((..(((.......))).)))).....))..)).))))))))},.............))).)))))})))))))}))))||{|||{{.,,,,)))))}}}.{(((((.((((..((..(((,....,.)))..)).))))..))))))||{{{{{((({.{.||||{,||||.,,,..(((((((((..((((((((((....))))}.,{{{{{,{....{(((((..{{|||,|,...,)))))..)),)))))))))))))))...,,}}{||||||{|{.}|}}..}.,}}})}})),...(((((...)))))..))))))))))}{((((((((.((.{,((((((.(((....(((.(((.((....{((((((((..((({,((((({{{.,{{........|||,{{,...||,.....((((((.....)))))).,.|,.....,,,....,,}},,,.......,......(((((((((((....(((((((.{{((((,...((((((...((((((.(((.(((((....))))))))))),}))...)))))).......,.)))).}})))))))..)))))).)))))...(((.((....)).))).}},}}.))))..))))))))}.)).))).)))...)))..))))))(((((((((...((((....({...,..{{..((((((((((......))))).))))).))...,,...))))...))))))))){((((((..((((({...{{{,...({{{.......})))((((((((((.,....,}}}...........)))))))..........{((((.((((((...))))))...)))))}}}}))))).))))))}....,})).)))))))))}}).}))),.)))))))).,,.,,,,.......(((((((((((.(((((((((((((((((.((((((({........(((((((((.(((.({..((((((....(((.((((((((((.,,,{,((((,,,(((((..((((.((,(,........}},)).))))..))))},}}}..((((..(((((...(((((((....))))))))))))..))))....(((((,({.,,.)),}}}}},||{{||{({.((|((((.{,.||||,|))}|},,.|{{||.{{|,,(((((...((.(.((((((,....,.)))))),}))...)))))|{{{{{.|||||,,{{(({((((((......))))))..))}),))},.||||||(((((.....(((...(({....})).)))..,..)))))|||||||({{{{||||||,.....{((((,...|}}}}},.,))))))))))}|||,}}}}},,,,||{{{||,,......,||..,,,}}}})))},},}}}},..)))))))))).)))....)))))).}).))}..)))))))))................((((((.(((((((((((((......)))))))))))...)))))))).(((((...((((((((....))))))))...)))))............((((((.{({{........))}}))))))|,,,....,,)))))))))))))..((((((((((((((.....)))).)))))))))).(((,,(((((.,,..,,,,.((((.......))})..}}..}},)))))...},,...,,,,,,)))))))))))).)))))))))))..,,,,,..|||,{{{,,,,,,||||,,{...,,{,,,..,||||,.|,||,.,}}))}})}}}}}}.}}}}|})))).....(((({(((,..(((((..,,.((((..(((({{{,,,,,.......,))}.)))).((((((......{{{|.....,,}}}}}..,,)))))))))).,,.))))),,)))),)}}}(((((((..(((...(((((........)))))...)))..)))))))...((((.((((((((.{,...{(((((......((((...(((((..(((.(((..((((((...))))))....))).)))..)))))..))))......)))))),.)))).)))).)))){(({({(,..(((((....,...(((((({..(((..(((((.............)))))..)))....))))))).,.,)))))...}}},}))))..........,.)))))}))),))))))},,,,{{,..{{{{{{|,,,,,,)}}))}},}}}|,|}|||||,...,,,,)))}||,|||,|||{{{{{{..,})))}}..,}}}}......,,,|||}}}}},|}}}},,......{((((((.{,.(({(((,,{,,,....}}},....))).))).,,.))))))}.((((.......)))).,)),..}},,,,......

Transcripts

ID Sequence Length GC content
GAGAGCGCGGUGGAGAGCCGAGCGGGCGGGCGGCGGGUGCGGAGCGGGC… 4627 nt 0.4904
UGACUGCAGCAGCAGCGGCAGCGCCUCGGUUCCUGAGCCCACCGCAGGC… 3890 nt 0.4550
Showing 11 to 12 of 12 entries
Summary

The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member is a high-affinity receptor for acidic, basic and/or keratinocyte growth factor, depending on the isoform. Mutations in this gene are associated with Crouzon syndrome, Pfeiffer syndrome, Craniosynostosis, Apert syndrome, Jackson-Weiss syndrome, Beare-Stevenson cutis gyrata syndrome, Saethre-Chotzen syndrome, and syndromic craniosynostosis. Multiple alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2009] CIViC Summary for FGFR2 Gene The FGFR proteins are involved in a wide array of pathways known to play a signficant role in cancer. Activation of these receptors can lead to activation of the RAS-MAPK pathway and the PI3K-AKT pathway, among others. The mechanisms by which FGFR can be misregulated vary between cancers. Amplification of the receptors has been observed in lung and breast cancers, coding mutations and deletions have been seen in many cancers, and more recently, FGFR fusions that lead to pathway actiation have been demonstrated to have oncogenic potential across multiple cancer types. The targeted therapeutics ponatinib, dovitinib and pazopanib have seen success in treating over-active FGFR signalling, prompting use of diagnostic sequencing targeting the FGFR genes, especially in lung cancer patients.

Forensic Context

A study in porcine skin demonstrated that the FGFR2 was significantly decreased at 7 days postexposure to both sulfur mustard and thermal burn injury, identifying it as a potential therapeutic target for wound healing due to its important role in transducing FGF2 signaling during the repair process [Price et al. DOI:10.080/15569520903097754].