| ID | Sequence | Length | GC content |
|---|---|---|---|
| GACAGUGCUGACACUACAAGGCUCGGAGCUCCGGGCACUCAGACAUCAU… | 1565 nt | 0.4045 | |
| GACAGUGCUGACACUACAAGGCUCGGAGCUCCGGGCACUCAGACAUCAU… | 2072 nt | 0.3716 |
The protein encoded by this gene is the gamma component of fibrinogen, a blood-borne glycoprotein comprised of three pairs of nonidentical polypeptide chains. Following vascular injury, fibrinogen is cleaved by thrombin to form fibrin which is the most abundant component of blood clots. In addition, various cleavage products of fibrinogen and fibrin regulate cell adhesion and spreading, display vasoconstrictor and chemotactic activities, and are mitogens for several cell types. Mutations in this gene lead to several disorders, including dysfibrinogenemia, hypofibrinogenemia and thrombophilia. Alternative splicing results in transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
A study in human blood plasma demonstrated that the FGG (Fibrinogen gamma chain) was significantly upregulated with age and was used as part of a 21-protein panel to build predictive models for chronological age [Salignon et al. DOI:10.18632/aging.204787]. The protein-based model achieved an R² of 0.59 ± 0.02, and combining this proteomic data with miRNA data significantly improved prediction accuracy to an R² of 0.70 ± 0.01, capturing a broader range of age-related physiological changes.