Basic Information

Symbol
FITM2
RNA class
mRNA
Alias
Fat Storage Inducing Transmembrane Protein 2 FIT2 DJ881L22.2 C20orf142 Acyl-Coenzyme A Diphosphatase FITM2 Fat-Inducing Protein 2 Fat Storage-Inducing Transmembrane Protein 2 Chromosome 20 Open Reading Frame 142 Fat Inducing Transcript 2 Fat-Inducing Transcript 2 EC 3.6.1.- SIDDIS
Location (GRCh38)
Forensic tag(s)
Chronological age estimation

MANE select

Transcript ID
NM_001080472.4
Sequence length
4628.0 nt
GC content
0.4842

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1861.50 kcal/mol
Thermodynamic ensemble
Free energy: -1939.93 kcal/mol
Frequency: 0.0000
Diversity: 1093.47
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((((.((.(((((((((((((((((.((..((.(((...((((((((((((((((....(((((..(((.(((.(((((((.((((..(((....((((((((((((.((.((((((.(((...)))...)))))))).))))..((.((((...((((....))))..))))))))))))))..)))..)))).))))))).))).((((.....))))(((((((((((.((((.(((((((((((....((((((((((....((((((...((((((.(((...........((.((((.((...(((((((((....).)))))))).)).)))).))((((..((....((((((((.((((.((.............................)))))).)).))))))..))..))))))).))))))..))))))((((((((((.((((((.((((((..((((..((((((...((((..(((...(((((((((((((((........).))))))((((((..(....)..)))))).))))))))...)))......(((........)))...))))..)))))).....(((((.((((...)))).)))))))))))))))))).))).).))).)))))).(((((.((((((.(((((........(((.(((.........(((((((...))))))))))))).......))))))))))))))))..((((((.((....(((...(((...((((((.....((((((.(((((((..((((.......)))).((((((((.........(((((.((..(((((((((((.(((((((...(((((((((......(((((((..((.......))..))))))).........(((.......)))((((..((((.(((((((.......(((((((((((((..((((((((((.((....)).)))))))))).......(((((((.....))))))).)))))))))....((.....)))))).......)))))))..))))..))))...(((((((...((((..(((((((...)))))))..))))..(((....(((((((....((((...(((....(((.((((((......))))))..)))..)))..))))...)))))))....)))))))))).(((((((........(((((.......)))))((((....))))......((((.(((.((((((((((..(((.(((((((.(((((((((((((((((((((((.((((((((((.(.(((((((((.((((((((((((.(((((((((.(((((((((((((.((((((((((((((.((((((.(((((((((((.(((((((((((((((((((((((.(((((((((((((((((((((((((((((((.(((((((((((((((.((((((((((((((..(((.(((((((((((((((((((((((((((((((((.((((((((((((((((((((((....((((.......))))....)))))).((((....))))............))))))))..)))))))).))))).))))))).))))))))))))))))))))).)))..)))))))))))))).))))))))))))))).))))))))))))))))))))))))))))))).))))))))))))))))))))))).))))))))))).)))))))))))))))))))).)))))))))).))).))))))))).)))))))))))).))))))))).).)))))))))).))))))))))))))))))))))).))))))).)))..)))))))))).))).))))(((((((((((.(((....))).)))))..)))))))))))))......(((((((((((((((((((....)))))....)))))))))))))).......)))))))))....(((((((((....(((.((...)).)))..(((((.(((((((.((((.........((((((...((......)).)))))).......))))))).)))))))))....(((((((..((((......))))..)))))))....((((((((...(((((((((((...))))))))))).))))))))...(((.....)))..((.(((((((((.(((.((((((.(.....).))))).).))).))))))))).))(((((((((((((((((((.(((((...((((((....((((((((.((((..........)))).))))))))...))))))...))))).....((((((((((....((((..........)))).......((.(((((((((((((((.....)).)))))..)))))).))..)).....))))))))))(((((....)))))((((((...(.(((((.(((((((..(((((((((...(((((((.....................)))))))..(((((((............))))))).........((((...(((((..((((....))))....)))))))))...(((.((((((.(((((.(((((.......)))))...)))))..)))))).)))((((.....))))......))).)))))))))))))..((((((.((....)))).)))).........(((((.(.((.(((...))).))).)))))((((.....))))........((....((((((((....))))))))....))..))))).)...))))))...........))))))).))))))..))))))......))))))))).((((((........)))))))))))))..)))))))))))..)).)))))...((((((((.(((((((.....(((....)))))))))).))))))))(((..(((((((.((((((.............(((..........)))..)))))).)))........))))..))).))))))))..((((.((((((((...((((((((.(((((((((((....))))).(((((.(((.((.((((((((((((((((..((((...((((.((.((......)).)))))).....))))((((((...))))))...(((((.((((((....(......)....)))))).)))))..((((((..............))))))......)))))))........((((((((((..((.((.....((((((.(........).)))))).)).)).)))))).))))..))))).)))).)).))))))))(((((.((((........)))))))))..((((((((.((((...(((....)))..)))).))))).))))))))))))))))).)))))))).)))).(((.(((((((((((((((.((((.....))))))....))))))...))))))))))((((((((...((((.....(((((((....)))))))....)))).....))))))))......................((((((((......))))))))......))))).)).)))))))))))).)))....))))).))))))))))))))))((.(((((((.((.........)))))))))..))(((((..(.((((((((...)))))))).)...........))))).......(((((.(((((....((....)))))))))))).((((((((.((((......)))).(((((((...((..(((((....))).((((((((...((.(((((((.((((......(((.((...((((((.((.(((..((((((....))))))....))).)))))))))).)))....)))).)))))...((((((......))).))).))..))....))))))))..((((...((((......(((((((((((((((..........((((((((....))))))))((((((..........((((((....)))))).....(((((((((((........))))))))))).((((.(((((...(((.((((((.........)))))).))).)))))..)))).((((((....(((((.(((..((...(((((....))))))).))).))))))))))).....((((.....)))))))))).....)))))))))))))))........))))))))....))..)).)))))))))))))))))))))))..))).)).)).))))...))))))))))..)))))....)))...))))))))).))))...)))))..)))))).))))))..)))).))).))(((((((((...)))))))))....((((.....)))).))))))))....((((((((.....)))))))).......................................
Thermodynamic Ensemble Prediction
...,,(((((,.{.(((((((..((((((,(((.((.(((.((((...(((((,,,,,((((,.,((((.(((((.((.((((...(((((({.((((,,{((((....)))))))))))).)))))....)))))).)))))))))))))){({(((,.{.((((....))))..},,)))}},((((,((.(((((....((((.{{{,((.,(((.....}))))).},))))....)))))))))))}}))))))),.))).)).))).))))))..))))))).,...|||||.{{{(.,,((({{((..((({(((.(({{{{((((((({(((((((.(((..((((..((....((((((((.((((.((.......,,,,.......}}.........)))))).)).))))))..}),.))))..))),))).((((((.,(((((((((,.((((((.((((({.{((((..((((((...{(((.{(((,,,(((((((({((((((........).)))))}((((((..(....}..}))))),)))))))),..))}.,,,..{|{........))),,,))))..)))))).....(((((.((({...}))).)))))))))))))))))).))).,.)))})}))))..,.)))))}{(({(||((.{{{{{{{{{{{..,,,||,,|||{((((((...))))))},|||||,.{{{{{|||{,{{{||(({{,|,{(({({({((.,,}}}}}},||{,{{(({{{{.....((((((.(((((((..((((.....,.}}}}.((((((((....{{,..{((((.((..(((((((((((.(((((((...(((((((((...,..{((((((..((.......})..)))))))..}}.....{({.......}}|((((..((((.(((((((......,(({{(((((((((,.((((((((((.((....)).)))))))))).......(((((((.....))))))).)))))))))....||,....||||},...}}},))))))}..))))..)))),..(((((((...((((..(((((((...}))))))..))))..(((....(((((((....(((,..{(({....{{{.((((((......})))))..})}..))}.})))).,.))))))}....)))))))))).{((({{{.,......{{{{{......,|||||(,,,.,,}))))......{(((.(((.((((((((((..(((.(((((((.(((((((((((((((((((((((.((((((((((.(.(((((((((.((((((((((((.(((((((((.(((((((((((((.(((((((((((((((((((((.(((((((((((.(((((((((((((((((((((((.(((((((((((((((((((((((((((((((.(((((((((((((((.((((((((((((((..(((.(((((((((((((((((((((((((((((((((.((((((((((((((((({((((....((((.......))))....}}}}||,,,,,,,..}},,.,,,,...,,}.)))))))))}}}}))))).)))))))))))))}})))))))))))))))))))).)))..)))))))))))))).))))))))))))))).))))))))))))))))))))))))))))))).))))))))))))))))))))))).))))))))))).)))))))))))))))))))).)))))))))))))).))))))))).)))))))))))).))))))))).).)))))))))).))))))))))))))))))))))).))))))).)))..)))))))))).))).)))|(((((((((((.(((....))).)))))..))))))))))))}...,,,(((((((((((((((((((....}))))....))))))))))))))}......)))))))))....(((((((((....(((.((...)).)))..(((({{(((((((.((((....,,...((((((...((......}}.)))))),,.....))))))).)))))))))....(((((((..((((......))))..)))))))....((((((((...(((((((((({...})))))))))).))))))))...,,,.,..{|||.(((.(((((((((.(((.((((((.{.....}.))))).).))).))))))))).)))|||||||((((((((((({{{,(({{,{,(((({{((((((((((.{(((..........)))}.))))))),...||||||{,,}|}||{,...((((((((({...{{((,.{,{{..,{.,,,),..},,,((,(((((((({((((((.....))}}))))..)))))).))..))}.,,)))))))))))(((((....))))){||||{,.,|}||||||(((((((..(((((((((...(((((((.{,,...........,.....}))))))..(((((((..,,....,,..)))))))....,,...((((...{({{(,.,,,,,{{,|},}}}.,}}}}})))).,,|{(.({((((,((({{.{{{||,,,...,))|||.,,|||||,.}|||}}.}},{|{|,},},))))}}.}}}))).))))))))))))).,((((((.((....)))),}))).........(((({.(.((.(({...})).)),,))))){(((.....)))).......,((....,(((((((....)))))))}|,.{|}.,,||},.,.,,),))}),....,,},..)))))))))}))))})))))))}.,},.))))))))).{(((((........)))))})))))))..)))))))))))..)).)))))...||{(((((.(((((((.....(((....)))))))))).)))))|||(((..,((,{((.((((((.............(((..........))).})))))}.))).}}..},,))}}..,,,.))))))))..((({.((((((((,{.(((((((,,((((({(((((....))))).(((({{(((.((.((((((((((,,,,,,...{{{,.,(((({(,.,,..,,{,{|.}|||||{(((..{{{((((((...))))))..,}}}},.{{(({,...))))))))}}}..,|||}}}))}}}..||||({.........,....}}}}}|,.....}}}))}}},......{(((((((((..{{.,{..{..((({(({(.,{.....)},)))}}.,},)).)))))).)))).)))))).)))).)).))))))))|((((.((((........))))))))}.,{(((((((.((((...(({....)))..)))).))))).)))))))))))))))))))))))))).}))}.(((.((((((((((((({(.((((.....))))}}....)))))).},,}))))))))((((((((...((((..,..(((((((....)))))))....)))).....))))))))..{{,,...........}}}}.((((((((......))))))))......))))).)).)))))))))))),|||||....{{{{{,.{|||||((((.(,((.(((((((.((.........)))))))))}}}}.)))),,{.((((((((...)))))))).,...........,||||{,|,...(((({.{{{{{.,,.|{....|||||,|||||,,(((.,..},|{{((({{{.....|||{||||.....{{{{,||||,.,..,,.,|||{||||{.,,)}))))))}},.......,...|}}}{||||||||}|||..{{{{||,..,))))}|..,,|||{||},,,))}.,,|||,..|||{,{||||,,,|||||.||||||})),}}|,|{{{((,,(,,.{{{{{,|...,,..}.}}}))}).)))))}},,})))})})))),.,,,.{(((((((,..,||}}}}}}||{{||,,.,{{{{{{({((,({{{.,||||,.....||||,,|||||}.}}}}}})))))))))))},}}...,,|}}},,,,..,||||}}}}}....,))))..)))))))).}}))}}}|||||,.,.,(((((.(((..,{...(((({....)))))}}.))).))))))))))).,...{{{{.....)))}||}}}}|,,}}}}}}}||||}|}|{|,,,...,.|}}}}}}|,,|{{{{.(({{{((((((((..(((((((...))))))).{(((..{{.(((((((....{{.{........,.))..)))))))}}.))))......))))))))....))))).)}))}|,,{,({{((,,((((({{{|,,,,,,))}}}))))..}}|||...,))))}||{{.,.((((((((.....)))))))).,},,}},......,,...,,},.|||......,,}.,.

Transcripts

ID Sequence Length GC content
GAUACGGUGGCCGAGAGGGCACGGAGAGGAGGACGGUGGCUGACGAGAU… 4628 nt 0.4842
Summary

Enables coenzyme A diphosphatase activity. Involved in several processes, including fatty-acyl-CoA catabolic process; lipid droplet formation; and lipid homeostasis. Predicted to be located in endoplasmic reticulum and membrane. Predicted to be active in endoplasmic reticulum membrane. Implicated in Siddiqi syndrome. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in humans delineated age-associated mRNA expression patterns in peripheral blood and established a robust age prediction model using 34 mRNA markers, including the FITM2 which was identified for the first time as an age-related gene involved in lipid droplet formation and lipid storage [Liao et al. DOI:10.1016/J.Fsigen.2025.103373]. The elastic net model demonstrated strong performance with a mean absolute error of 6.72 years on the test set and 7.56 years on internal validation, confirming the utility of these markers, including the FITM2, for forensic age estimation.