Basic Information

Symbol
FKBP10
RNA class
mRNA
Alias
FKBP Prolyl Isomerase 10 FKBP65 HFKBP65 Peptidyl-Prolyl Cis-Trans Isomerase FKBP10 FK506 Binding Protein 10, 65 KDa 65 KDa FK506-Binding Protein FK506-Binding Protein 10 Immunophilin FKBP65 PPIase FKBP10 65 KDa FKBP EC 5.2.1.8 FLJ22041 FLJ20683 FLJ23833 Rotamase FKBP-10 FKBP-65 FKBP6 Osteognesis Imperfecta With Congenital Joint Contractures Telopeptide Lysyl Hydroxylase, Bone-Specific FK506 Binding Protein 10 (65 KDa) FK506 Binding Protein 10 PPIASE BRKS1 BRKS OI11 TLH1 OI6
Location (GRCh38)
Forensic tag(s)
Wound age identification Mechanical injury analysis

MANE select

Transcript ID
NM_021939.4
Sequence length
2585.0 nt
GC content
0.5926

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1072.90 kcal/mol
Thermodynamic ensemble
Free energy: -1112.84 kcal/mol
Frequency: 0.0000
Diversity: 605.79
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((..(((((((..(((...((((((.(.((((((((...((((((((...(((....(((((((((((((((((.(..((((...))))..).)).)).)..))))).)))))))(((((((......)))))))))).))))))))(((((..((((((((.(((....))))))))))).))))).((((....)))).(((.(((.((((((.....(((.(((((((........((......((..(((((..(((......)))..)))))..)))).......)))))))))).(((((((((((...))))).)))))).(((((((...(((((.((....((.(((......))).))...)).))))).))))))))))))).))).)))..)))))))).))))))).(((...(((((....)))))...)))............)))..)))))))..)))((((((((((((((((((.....))))((((...))))..((((.(((((((((((..(((.((((..(((.((((((..(((((....((((((((..((((((((((((((((((...(((((((...(((((....(((((.......)))))(((......)))(.((((((((.(((.......)))...)))))))).).)))))(((((((((..((((.((...(((((((..........(((....)))((((((((.......)))))))).((((((..((......))..)))))))))))))...)))))).)))..))))))......))))))).))))))))))...((.((((((((.((((((((((((.((....)).)))))))...)))))))))).))))).(((......))).(((.....)))((((.((((..((.(((((.......((((........................))))..(((.........))).))))).))..)))))))).))))))))(((..((((((.....((.......)).)))))).))).(((.((...)).))).(((((..((((((..((..(...(((...))))..))..))))))...)))))(((...))).(((.((....)).)))))))))))......)))))..)))...))).)))..)))))))...(((.((.(((....))))).)))...((((((((.......((((....(((((((((((.....))))))))....))).....))))((((((...((((....)))).)))))).....))).)))))(((((((....)))))))...))))).))).(((((..((..((((..((.......))..))))..))..)))))(((((((.(((((((.(((....))).)))...(((((((((((((((...((((..(((((.....((.((((.(((((((((((((((.....))))))).)))....)).))))))).))....((((....)))).(((((((..((....))..))))))).....((((.(((((...(((((......((((....)))))))))...))))).))))....(((((((...(((((.(.....).)))).)...)).))))).)))))..)))).....))))))).))..)))))).((((((((((.((((..(((((.(((....((((((.((.(((....))).))))((((((..(((.(((.((((((((((((((((((((((....(((.(((((((...(((((((((((.....))))))....))))).)))))))(((((((((...(((.(((.((((..........))))...((((....))))((((....))))..))).)))....)))).)))))))).)))))...)))))))...((((.(((((..((((..(((((((.((((((......))))..)).)))))))...))))....))))).))))..))))).)))))))).)))..))...)))).))))....)))))))).)))))))))))))).)))))))))))................((.((.....))))..(((((((((((((((...(((.....((..((...((((((.(((((((.((((((((((((...((.....))......)))..))))))))).......(((((((....((((.(.(((((((((((...((.(((((((((((((((...((((.((......)).)))))))))))))..((..((((((....)))))).))............((.(((((.....))))).))......))).))).))...))))))))))).).))))...)))))))))).)))).))))))...))..))...)))...))))))).)))))))).))).)))).(((..(((.(((((...((......))))))))))..))))))))).))))))))..................
Thermodynamic Ensemble Prediction
..{{{..(((({(({{((....((((((.(.((((((((.,,((((({{(,{,(((.,..(((((((((((((((((.(..((((...))))..}.)).)).}..))))).)))))))(((((((,.....))}))))}}|{||||||,|(((((..((((((((.(((....))))))))))).)))))},,,|}}}}))),.(((.(((.((((({.....(((,,,,.,,,,......{||||...{((..(((((..(((......)))..)))))..))}.....{{{{|||,||||,.(((((((((((...))))).)))))),|||,{,,,}}||||(,{,..}|((.{({,,,,,.}}}.}}{,,}},)))}).,,)))))}))))).))).)))..)))))))).))))))).|||}},{{{(({,.,|||,|{{{|,,{{......)}.))))},)))}))),.)}}((((((((((((({((((,,,,.||}|{(({...,|||.,((((.(((((((((((..(((.(((({{((.{((,(((..(((((....((((((((..((((((((((((((((((...(((((((..,{((((,...{{,{({{,,,,.,,,,}{,{.,,,..))}||||{|{,{{|{||{{{{{{(((({{({{(((({{,{{.}|||{,.|}}|||||((((.(,({.(((.{,...}).)))}))).,}}|((,((((((((.......)))))))).))}})}},..))}},,)))),,,)))))},..{{{|||},...,,,.))))}),...,,.))))))).))))))))))...((.((((((((.((((((((((((.((....)).))))))))..))))}))))).))))).(({......})).(((.....)))((((.((((..((.(((((.{{....,,,|........................,)))..{||},.......,}}.))))).))..)))))))).)))))))).((((((.(((..(((((.......{({({|((({{{.....}|....)))).).|)))...,(({.....,.))})))))))).))))))......,,...|||}|,|||..,))}.(((.((....)).)))))))))))......)))))..)))}}},}}.}))}.)))))))...(((.((.(((....))))).)))..,((((((((.......((((....(((((((((((.....))))))))....))).,}..))))((((((...((((....)))).)))))).....))),}))))(((((((....)))))))...))))).))).(((((..((..((((..((.......))..))))..))..)))))(((((({,(((((((.(((....))).)))...(((((({((((((((,..((((..(((((.....((.((((.(((((((((((((((.....))))))).)))}...|}.))))))).))..,,({{{,,..|},,.(((((((..({....))..))))))).....((((.(((((...((((({{....{{,,...,}})))))))...))))).))))....(((((((,,.{((((.(.....).)))).}.,.))}})))).)))))..))))..,..)))))))}.}..)))))).(((((((((,,((((..(((((.((({,,.({(({(.((,(((....))).))},{{((((..(((.(((.((((((((((((((((((((((....,,{.(((((((...(((((((((((.....}}}))).,}.))))).)))))))(((((((((...(((.(((.((((..........)))),{{((,,...,)))|((((....))))..))).)))....)))).))))),}).)))))...)))))))...((((.(((((..((((..(((((((.{(((((......)))).,)).)))))))...))))....))))).))))..))))).)))))))),)))..))...)))),)))),.,.)))))))).)))))))))))))).)))))))))))................,{.{(.....)}},..(((((((((((((((...(((......{..{(,..((((((.(((((((.((((((((((((...((.....}}......)))..))))))))).......|((((((....((((.(.(((((((((((...((,(((((((((((((((,..{(((.((......)).))))))))))))).,|,..||{{{{..,.)))))}.||.........,..((.(((((.....))))).))......))).))).)}...))))))))))).).))))...)))))),))).)))).)))))),..)}..,,...)))...))))))).)))))))).))).)))),{||,.|||,{|,||...{{,.....}}))))))}}..}}}}}))))}}}))))))..................

Transcripts

ID Sequence Length GC content
CUCACUGCCGGCGGUCCCAACUCCAGGCACCAUGUUCCCCGCGGGCCCC… 2585 nt 0.5926
Summary

The protein encoded by this gene belongs to the FKBP-type peptidyl-prolyl cis/trans isomerase (PPIase) family. This protein localizes to the endoplasmic reticulum and acts as a molecular chaperone. Alternatively spliced variants encoding different isoforms have been reported, but their biological validity has not been determined.[provided by RefSeq, Nov 2009]

Forensic Context

A study in mice demonstrated that exposure to γ-rays induced a down-regulation of the FKBP10 in liver tissue, as identified through oligonucleotide microarray analysis and validated by real-time PCR [Roudkenar et al. DOI:10.1269/jrr.07078]. A study in Wistar-albino rats demonstrated that the FKBP10 gene was down-regulated at 12 and 48 hours following mild traumatic brain injury, as identified through whole genome microarray analysis [Colak et al. DOI:10.1016/j.injury.2012.01.021].