| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCUACCCCAGCUCUCGCGCCGCGUGCAGAGGUGCUCAAGCCUCCUCGCG… | 3715 nt | 0.5098 |
The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds to the immunosuppressants FK506 and rapamycin. It has high structural and functional similarity to FK506-binding protein 1A (FKBP1A), but unlike FKBP1A, this protein does not have immunosuppressant activity when complexed with FK506. It interacts with interferon regulatory factor-4 and plays an important role in immunoregulatory gene expression in B and T lymphocytes. This encoded protein is known to associate with phytanoyl-CoA alpha-hydroxylase. It can also associate with two heat shock proteins (hsp90 and hsp70) and thus may play a role in the intracellular trafficking of hetero-oligomeric forms of the steroid hormone receptors. This protein correlates strongly with adeno-associated virus type 2 vectors (AAV) resulting in a significant increase in AAV-mediated transgene expression in human cell lines. Thus this encoded protein is thought to have important implications for the optimal use of AAV vectors in human gene therapy. The human genome contains several non-transcribed pseudogenes similar to this gene. [provided by RefSeq, Sep 2008]
A study in human neonates with hypoxic-ischemic encephalopathy (HIE) identified the FKBP4 as a top differentially expressed gene associated with adverse outcome (death or disability at 18 months) in the South Asia cohort, where it was upregulated (log2 fold change, 1.18) [Montaldo et al. DOI:10.1001/jamanetworkopen.2023.54433]. This gene is a chaperone molecule promoting protein folding and is associated with oxidative stress, and its expression profile was part of a distinct genomic signature linked to nonacute hypoxia mechanisms in that population.