Basic Information

Symbol
AKAP5
RNA class
mRNA
Alias
A-Kinase Anchoring Protein 5 AKAP79 AKAP75 CAMP-Dependent Protein Kinase Regulatory Subunit II High Affinity-Binding Protein A Kinase (PRKA) Anchor Protein 5 A-Kinase Anchor Protein 79 KDa A-Kinase Anchor Protein 5 AKAP 79 H21 A-Kinase Anchoring Protein 75/79 AKAP-5
Location (GRCh38)
Forensic tag(s)
Wound age identification Sudden death from CNS diseases

MANE select

Transcript ID
NM_004857.3
Sequence length
6487.0 nt
GC content
0.3690

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1921.80 kcal/mol
Thermodynamic ensemble
Free energy: -2042.53 kcal/mol
Frequency: 0.0000
Diversity: 1715.45
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((((..((((((..((((((....)).((((((..((((....(((((((.((.......)).))))))).))))))))))((((..((((.(((.(((((..(((((.......(((((..(((((.......)))))..)))))))))).((((((...................((((...(((((.((....((((..(((((.......)))))...))))......)).))))).))))))))))((((((....))))))..........((((((..(((...((((((.(((((((((..(((......))).....................((((((((.(((((..(((....(((.............)))...)))....)))).).))))))))))))))))).))))))..)))..))))))((((...(((....)))...))))...(((.((..(((((((((((....))))............)))))))..)).))).......(((((((.....((((((((((((......)).)))).((((((....)))))).)))))))))))))....)))))..))).)))).))))..((((((((((.....(((((.(((((((((.(((((((..(((((....)).((((.(((.((.....)).))).))))...)))))))))).)))))))))...............(((((.......))))).)))))............((((..((.....(((((....))))).........(((....((((.(((..(((...((((((((.....((((((((((((......))).((((((((.((((...((((..(((.......)))..))))(((....((((..((((.......))))....))))))))))).)))))))).......((((........))))((((((....)).)))))))))))))....)))))))).....))).))).))))...))).....))..))))..(((((((..............)))))))...))))))))))..)))).))))))...))))(((((((((((.......................((((((((((..((..((...((((..((..(((((.(.........).)))))...))..)))).)).))..)))))))))).....((((......)))).....((((((((((((.((((((((........(((((((.((((((((.(((((..((((((((...........(((((((........(((((((((.((((.(((.(((((..(........)..)))))(((((((((((((((((((....))))).....(((........)))........((((((.......((((.((((....)))).))))....))))))..)))).)))))))))).(((((((((......)))))))))............(((((((.(((((((...(((((..((....((((((((.(((((((((....).)))))))).))..((((((.((.(.((((...((((((.......(((((....(((((((........)))))))(((...........)))....)))))....)))))).)))).).)))))))).((((...(((......((((((.....)))))).....)))...))))...((((((..((((((((((..(..(((.((..(((((...)))))..))...)))..)..)).))))))))..))))))..((((......))))(((.(((((((.........(((((.(((((((.........((...(((((((((...((((((..(..(((.(((.((((....((((..((((((....))))))))))...))))))))))..)....)))))))))))))))...))......))))))).)))))...............(((((((....)))))))..))))))).)))..(((((((((....((((((((.((((((((((.(((..(.(((((((((........)))))))))).))).)))...((((((.((((((((.(((((((((((.((((((((((((((..(((((((.....)))))))(((((.((..(((((.((((((((.((((....(((((...............((((.(((((.((((((((.((((.(((((((((((((((((((((((.(((((((.((((((....((((((((((.(((((((((.((((((.((((((((((((((((((((((((((((((((((((((((((((((((((.((((((..((((((((.(((((((((((((((((((((((((((((((((.(..((((((((.(((((((((.((((((.(((((((((((((.(((((((((((((((((((((.((((((.((((((((.((((((((((((((((((((.(((((((((..((((((.((((((.............((((........)))).((.((((((...(((((((((((.......)))))))))))))))))))..(((....)))....((((((......))))))((((((((((...(((.........))).................((((((.((.((((((........)))))))).))))))..........))))))))))...))))))..(((((.((((....)))).))))).((((((((((......(((((....)))))((((((((((.....((((...)))).......((.(((((............))))).))....))))))))))(((((....)).))))))))))))))))))).....((((((((((((.(((....)))((((........))))(((((((((......((((........))))..((((((....))))))..)))))))))....)))))))....))))).))))))))).)))))))))))))))))))).)))))))).)))))).))))))))))))))))))))).))))))))))))).)))))).))))))))).))))))))..).))))))))))))))))))))))))))))))))).))))))))..)))))).)))))))))))).)))))))))))))))))))))))))))))))))))))).)))))).))))))))).))))))))))..)))))).))))))).))))))))))))))))))))))).)))).)))))))).)).))))))).......((((...(((((((...............((((((((..((......)).))))))))((((((.((..(((((..((((((((((((((((((..(((..((((((..............((((((((..(.......)..)))))))).((((((....((((((((.(((..((((...))))..)))........))))))))....)))))).......((((((...)))))).((((((.((((((...((......(((...)))......))...))))))))))))..((((....))))))))))..))))))).)))))........)))).)))))..))))).)).)))))))))))))...))))((((((.....))))))....(((((((..............)))))))..........))))).(((......))).........)))).))).....)))))..)))))..)).))))).........)))))))))))...........(((((((((.(((((........((((........(((..((((((((....((..(((.(((((((...((((........)))).((((.......))))...((((((..((((.....((((((...))))))))))))))))....)))))))))).))...))))))))..)))..((.((((((((((..(((.((.....)))))..))).))))))).))((((((.((((........((((.....)))))))).))))))..(((((((((....(((((((...........)).)))))((......)))))))))))(((.((((..(((...........)))..)))))))..(((((...)))))))))......)))))...)))))))))....................))).)))...)))))))).)))))))))))))).............(((((....)))))..))))))).)))))))).....)))))))))....(((.(((((((((...(((((.....)))))...)))))))))))).))))))...))..)))))...)))))))...)))))))...))).)))).)).....)))))))((((((.....((....))....)))))))))))))))))))))...)).)))...((((.......(((((((((((((...((((.((((((((((((((((.((((.........((((((((....((((((....))))))........)))).))))...((((.((((.........)))).))))....((((((((.((((.(((.............))).)))).)))))))))))).))))))))))....((....))...)))))).))))...))))))))))))).............(((((((((......))))))))))))).)))))))).))).))))..(((((..((....))..)))))((((((.(((.((.........)).))).))))))))))))))(((((((((((((.....(((((..(((((.......)).)))..))))).......((((((......))))))..((((.....)))).......((((((((((((((.(((((.((((((((((.(((.......))).)).............(((((..((((((((((......((((((((((.(......(((((..((((((((.((((((.((((((((((((...(((.........)))..)))))))......(((.(((.......((((((((((((((((....((((.((...((((((((((((((..(((......(((..((((....))))..)))((((((((............))))))))(((..(((((........)))))..))).((((...))))..(((..(((((((.((((((((..........))))))))((((......)))).......)))))))..))).)))..)))).))))))))))...))))))))))))))...(((((.((((((.(((..((((..((((((......))))))..))))..))).))).))).))))).........((((((......))))))((((..((((((((((.(((((((.((.(((((((((((..............((((((........)))))).((((....).))).........(((((.........)))))(((((((..((((........))))..(((((.........))))))))))))...........((((((((......((((((......))))))...))))))))........(((((((........)))))))))))))))))).)))))))))........((((...((((((((...))))))))....))))((.(((((...........))))).))..))))))))))..))))(((((..((((.......((((((((((.((...(.((....)).)...))))))))))))..))))..)))))........((((((.......))))))..)))))))).......))).)))......))))).)))))).))))))))....)))))......).)))))))))).....))))))............))))..)))))...((((((...((((((........))))))...))))))....))))).))).))))).))))))))))))))((((((..(..((((((.......))))))..)..)))))).....(((((......))))).)))....))))))))))...))))).)))))))......))))))))))).......((((((...((((((...))).))).))))))..............
Thermodynamic Ensemble Prediction
...,,((((,.((((((..((((((....}}.((((((..((((....(((((((.((,....}.)).))))))).))))))))))((((..((((.(((.(((({..(((((.......(((((..(((((.......)))))..)))))))))),((((((...................{{,{..,(((((,((...,|(({,.{(((({.,,,||}}},....}}},......)).))))).}}}}))))}}((((((....))))))..........|(((((..(((,..(((((,.(((((((({.,{{{,,,..,||{{,{,......,{,,{,,....{||||||,.{{,,{..,,{,|,,||{|.....,{{...,}},..}}}}....}}}}.},},))}})}}}))))))).})))))..)))..))))),{(((...(((....}}}...}}}}...(((.{{..(((((({((((....}},}.....,,}}}},}}}}}}}.,}}.)))....,||(((((((,.,,,(((({(((((((......)).)))),{(((((....)))))).}}))))))))))),...,})))},))).)))).))))..((((((((((.....(((((.{((((((((.((((((,.,(((((....}}.((((.(((.{(.....)}.))).))))...)))))))))).))))))))},,........,....{((((.......))))}.)))))............((((..((.....(((((....))))).........(((....((((.(((..{((,..((((((((.....((((((((((((......))).((((((((.((((...((((..(((.......)))..)))).,({{...(((..((((.{....})))).,,.,,,)))})))).)))))))).......{(((........)))}((((((....)))}}))}))))))))....)))))))).,,,.,}}.))).))))...))).....))..))))..(((((((...........,..)))))))...))))))))))..}))).))))))...)))){((((((((({{{{,..,,{,,{,{{{{{,,,,.((((((((((..((,.{(...((((..((..(((((.(.........).)))))...))..)))).}|,||..}}}}}}))))..,..,{||.....,||,,...,||{{{{,,.||||.|||||.{,......,|{,,{((({.((({{((,,,,....|,}|}||||||........|,((((,.((....}}..}}}}...{{{{,,,..{(((,..{,.,,,,,,|..}}|||((((((((((((({(((((....)))))..,,,(((........))).,,,....{(((((..,....((((.((((....)))).))))....)))))}..)))).)))))))))),(((((((((......))))))))).....,,..,.,{{{{{{,,{{,,,{{{,,{({{{{,{{,,.,{{{{({|,,(((((((((....},,)))))||.||..{{{{||||{.|,|{|{,|,{,,,,,.......,,((({.,.(((((((........))))))),|,}}},.......|||,..,||||,..,,)))}}}.}}}},},}))}}}}}||,,,||}}.,.,,.}}((((((.....)))))).,.{{{{....}}}....,{||(({,({{{{|||||.....{|,.{{..(((({...}))))..}}.}|}}}..,.,)).)}}))))),,}})))},.,(({..,...}}}|(((.(((((({,,......,(((((.(((((((,,,...|},||...((((((((({..{(((((..{..((,{(((.{{,({{..((((..((((((....))))))))))..}))}}))))))..}....)))))))))))))))...||,....}))))))).))))).|.............(((((((....)))))))..})))))).)))}.{{{((((({.,,.((((((({.,{(({{{(((.(((..(.(((((((((........))))))))),.))).)))..,||((((.((((((((.(((((((({{{.{{{{{((((((({{.{(((((((.....)))))))|{{{{.{{..(((((.((((((((.((((.,,,(({{{.,,{{{{,,||....((((.(((((.((((((((.((((.(((((((((((((((((((((((.(((((((.((((((....((((((((((.(((((((((.((((((.((({((((((((((((((((((((((((((((((((((((((((((((((.((((((..((((((((.(((((((((((((((((((((((((((((((((.(..((((((((.(((((((((.((((((.(((((((((((((.(((((((((((((((((((((.((((((.((((((((.((((((((((((((((((((.(((((((({.,((((((.,,,(({.....,{{{{...{(({.......,))},.{{.((((({..,(((((((((((.......)))))))))))))))))})..,{|,...|}},...((((((......)))))){(((((((((...{((......,,......,..............((((((.{{.((((((.....,}})))}}},,.)))))).......,,.))))))))))...}}}}}}..(((((.((({....}))).))))).((((((((((,.,{,,((((({...,,)))||||||,|||.....{{{,,,,}))).,,,..,({.(((((............))))).))....}}}}}|}|,,(((((....)).)))})))))))))))))}}.}...{(((((((((((.{((....))}((((........))))((((((({,..,{{{((,,..{{,,,.,,,,..,,,,,.,}}}),,,))}})))))))))....))))))),,,,)}})).})))))))).)))))))))))))))))))).)))))))).)))))).))))))))))))))))))))).))))))))))))).)))))).))))))))).))))))))..).))))))))))))))))))))))))))))))))).))))))))..)))))).)))))))))))))))))))))))))))))))))))))))))))))))}))).)))))).))))))))).))))))))))..)))))).))))))).))))))))))))))))))))))).)))).)))))))).)).)))))))...,,,,||,{|{{{{|,,{|||,,..,,,,.,..,,,||||}}}.})}}}},,,{{{{{,.{((((((((.{(.,,(((({{(({,((({...,}}}..)}||||,.,.,,,.{{{{{{.{|,,...||,|||||,.|.,,,...}||}}}},|||........}}},,,}||||,((({{((({...}))},|)),.....,}|}}||,|}}||,}}.}}}}}}}}}.}||||{,.,{||||||{({{,{,...,,,|||||,.,,.,(((((((,{{((,,((({,((,,{({.((({{{..,,,,.}}}))),}}}{{{{{{((({((((((.(({...})).))))}}}))......))))}}}|{{{{(||||||||}||,((((({...,,}}}}}},|||||||{{,}}},}},,,,,}..}}}}}}}...,,,.,..|||||.{{{......|||......,,|)}}},))},....,})))..)))))..)}.}}}||,,,......))))))))}}},.,........(((((((((.(((((......,.((((........(((..((((((((....{(..(((.(((((((...((((,.......,}}}.||||....,..||||.,,{{{{{{,,||{{.....{{{{{,...,}}}}},,,,,,,})),...)))))))))).))...))))))))..))){{{,,{{||{(((,(,.(((.((((({.{(({...)))}.,|,,.|,{,((({{{..,||}}}},,,{((((.....)))))|||(((({|,.,||||}|||{,.{.{{{{{{{..,,,..,,,,)},})))),}.))))))))).}}}})|{{{.{(((..{((,,,{,......)}),,))))))),.{{|||,,,)}}}})))),.....)))))...)))))))))..,,................})).}}}...)))))))).)))))))))))}||((((({{{{..,.(((((....)))))}}))))))),))})))))..}},)}))))))),,..{{|{(((((((((...(((((.....)))))...)))))))))),}})))))}..,}}},)))))}}})}}}|||||,||||||},..|{||||||,{,,{{{{{{{|||(((((({.....((....))....}))))))}||},,,|||}||,.,.{({((({{{{{||...||||(({{{|{((({{{..{((((,...{((((((((((((((((((((((((,{(...........((((((....))))))...,))),)))),})))))))))...)))))))))))))))}..,......((((((((,(({{.,,,..,,..,,,,,..|||.||||.},}}}}},.....,,,.....,,....||,..,|||||}||||,..,,,...}})))})))))),....,}|,||{,,(((((((((......)))))))))|||{{{{{{|,||{||,.,.,)}}|,,,|}}}}}}},,},})}))|((((({((((((((((.,,.,(({....,...........)))..},.}}},}))))))}.(((((..(((((.......))}}))..))))))))))).((((((......))))))..,,,{,{||||||||.,|||{((((((((((((({.(((((.((({((({|||{,,.....,.{{{,,..,,.,,..,,..||..{{{{,{{{({{(((...,..{(((((((((.|...,,.{((((..|(((((((,({((((.{{{{,{{{{{{{...{{{,,,,,.,..)))..}}}}}))......(((,(((,.,,...(((((({{{|||{{||.,|,{{||,||,..((((((((((((((,,|||,,,}}|(({..((((....))))..))){(((((((............)))))))}{{{..(((((........)))))..}||,({{,..,))),...,{,.{{(((({.{{((((({.,,,....,}))))))))|||{......)))}.......))))))),.}}},,,),.))))},)))))))))...})))))))))}}}}...{((((.((((((.(((..((((..((((((......))))))..)))),.))).)))}})).))))}..{{,{{,.{{{{{,,,,,,{,}},..((((..((((((((((.(((((((.((.(((((((((({..,,,{,.......{.(((((((..{(({|.{({{.,,.....).)))...}))}..)))))))....,,,||.,,|||{{{{..,{(({{{{...,||||,{(,,,.,},..}}).}},,))))))}},,,........((((((((......((((((......))))))...)))))))).......,(((((((........)))))))))))))))))).)))))))))........((((...((((((((...))))))))..,})),}((.(((((.,,.....}}.))))).))..})))))))))..))))(((((..((((.......((((((((((.((...{.((....)).}...))))))))))))..))))..)))))..))}}..{{{{{{.......)))))),,)})))))),...,,.}}}.)))..,,..))))).)))))),)))))))}....)))))......}.)))))))))),}},.)))))).......,....))))}})))}}|},{(((((...((((((........))))))...)))))),}}}})))}.))).))))).}))))))))))))))}|}||}}},,||||||.,...,,})}}||{{||{||}|||,,,,,{(((((({..{{{,{{{.,{{{..,,)}}.}}}.},,,))))}}))))),,.....,)))))))))},,,.,||{{|||{||,||||||.,,}}}.})),)}}}}}},,}..,},,,},.

Transcripts

ID Sequence Length GC content
GCAGAGGGCGCCUUGCUCCGGGUGCGACCGCGGCUCCCUGGAGGCCUGG… 6487 nt 0.3690
Summary

The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein binds to the RII-beta regulatory subunit of PKA, and also to protein kinase C and the phosphatase calcineurin. It is predominantly expressed in cerebral cortex and may anchor the PKA protein at postsynaptic densities (PSD) and be involved in the regulation of postsynaptic events. It is also expressed in T lymphocytes and may function to inhibit interleukin-2 transcription by disrupting calcineurin-dependent dephosphorylation of NFAT. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the AKAP5 was downregulated 10.897-fold at 12 hours post-incised skeletal muscle injury, as identified by DNA microarray analysis [Gaballah et al. DOI:10.1016/j.forsciint.2016.06.027]. In human neonates with hypoxic-ischemic encephalopathy, whole-blood RNA sequencing identified the AKAP5 as one of 11 significant genes commonly associated with adverse outcomes across two distinct cohorts, where it was downregulated in a high-income country cohort but upregulated in a South Asia cohort [Montaldo et al. DOI:10.1001/jamanetworkopen.2023.54433].