Basic Information

Symbol
FLT3
RNA class
mRNA
Alias
Fms Related Receptor Tyrosine Kinase 3 CD135 STK1 FLK2 Receptor-Type Tyrosine-Protein Kinase FLT3 Fms Related Tyrosine Kinase 3 Stem Cell Tyrosine Kinase 1 Fms-Like Tyrosine Kinase 3 FL Cytokine Receptor CD135 Antigen EC 2.7.10.1 FLK-2 Growth Factor Receptor Tyrosine Kinase Type III Fms-Related Tyrosine Kinase 3 Fetal Liver Kinase 2 Fetal Liver Kinase-2 EC 2.7.10 FLT-3 STK-1
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_004119.3
Sequence length
3826.0 nt
GC content
0.4300

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1089.80 kcal/mol
Thermodynamic ensemble
Free energy: -1164.98 kcal/mol
Frequency: 0.0000
Diversity: 998.98
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((...))))))...(((((((..((((..((.((((((((...)))))))).))..))))..)))(((((((((.(((....))))))))).))).))))(((((((.......))))))).....(((((..................((((((.((((..(((.........((((((.......))))))......((((...(((((..(((....((((((...((.....(((((......)))))(((((...(((((((.((((..((((((((((((....(((....)))(((((((((((....))))))))))).))))))....(.((((........)))).).....)))))).)))))))))))...)))))((((((((..(((..((.((.....)).))..)))..))).)))))))...))))))......)))..))))).....))))((((((...((((((((((..((((((..(((((.....((((........)))))))))..)))))).)))((((.((((..(((((....((((.....))))..(((((...(((.(..((((((....)))))).).))).)))))((..((.(((((((.(((..(((..(((((((((((......((((..(((...((.......))....)))..))))........((((((((.(((((............(((((.((((.(((...))))))).)))))......(((((((.....))).)))).(((((...))))).............(((..........(((((((.......(((((((((((..(..(((((.(.((....((((......(((((((.....)))))))(((((....)))))...............)))))).).))))))..)))))))))))(((((....))))).(((((((((((.......)).)))))))))..............)))))))...........))).....))))).))))))))))))))).)))).)))))).)))))))..))..)))))))..)))))))).....((((..((((((((((....))).)).)))))........((((.(((((((...((((..(((((...)))))..........))))...))).))))))))....((((....))))(((((((.(((((((((..((((((.(((((.....)))))......(((........)))((((((((((..........(((((.((((((..(..((((((..((((.((...(((((((...)))))))....(((...)))...(((((......))))).)).))))..)))))))..))))).).)))))............))))))..))))..((((.(...(((((((.(..((((.((((.(((((((((....(((((.(((((((.......((((..((.....(((((((((..(((..(((...))).))))))))))))...)).)))).((((((((((.((.(.((((...(((((..............))))).))))).))..)))))))))).....))))))).))))).(((......))).....))))).)))).))))....)))).)))))))).).)))).)))))).....))))).....))))))))))).......))))...))))))).....)))))))))..))))))))))(((.(((((((((.....)))).(((((((..((((..(((.............)))..)))).))))))).................((((((((((((((.(((((...((((.((((((((((...(((((((((((((((((.((((..(((((..((((..(((((....((((..((.(((....((((.........))))))).)))))).....))))).......((((((.(((((.......((((((.((.....(((((.....)))))..)).))))))(((.((((...)).)).).))......))))).))))))...)))))))))((((((.(((((..........))))).....((((....)))).(((.(.((((....((((((((.((((((.........))))))...(((((((((.......((((..(((((((.....((((((..(.(((((((((((....(((....))).....))))..))))))).)..))((((((((((((....)).))))).)))))......))))......)))))))...(((((((((((((((((....)))))).))).)))))))).(((((((........)).)))))...)))).((((((((((...........)))).))))))(((((...)))))..((((.........)))))))))))))(((.((((((.(...(((((.(.(((((.(....).))))).).)))))))))))).))).((((...))))((((((((((.....((((((.........((((......)))).(((((.........(((((((((((......))).))))))))(((((((...)))))))..(((((((...........(((((((((((.((........)).)).....((((((...))))))((((((((.....))))))))(((........................))).((((..(((((....).)))))))).((((((((((...(((((.............))))).((((....))))((((((..........)))))).......))))))))))....))))))))).)))))))..((......))((((((.((.((.(((((((((........))).)))))).)).))...)))))).......)))))(((((......))))).(((........)))....))))))...))))))...))))...........((......))..........))))))))....)))).).)))..))))))........)))).))))))).)))))))).))...)))))))))).)))).......((((..((.(((((((....))))))).))..))))..(((((((((((((((((......))).)))))(((.(((((.(((..((((..((....(((((((..(((..........)))..))..)))))....))..)))).....)))...))))))))...........(((((.((.((((((((.(((.(((((((((..(((((.....(((((....(((((...(((((((((...)))))))))..)))))....))))))))))..))))))))).)))..)))))))))).))))).)))))))))....(((((.....(((((((.(((((((..((((((((((((((..((((((....)))))).............))))))))))))))..))))))).)).))))).....((((((((......)))))))).....)))))..........((..((((((...(((........)))......))))))..)).)))))..)))))))))))))).))))).)))(((.(((((...((((((....))))))......)))))))).)))))....
Thermodynamic Ensemble Prediction
..((((((...))))))...(((((((..((((..((.((((((((...)))))))).))..))))..)))(((((((((.(((....))))))))).))).))))(((((((,,,,...}}}}|||...,{(((((.....,,.,,...{,,,.||||||}|||,.,|||}},,,,,,.||||||,}}}}},)))),,.....{((((({.(((((..(((....((((((...{{.....(((((......})))){((((...((((((((((((..((((({{{((((....(((....)))(((((((((((....))))))))))}.,||||,..,}}}((((........)))).,.,},,)))))).)))))))))))...))))}((((((((..(((..,,.{,.....}}..,..)))..))).)))))))...))))))......)))..))))).....,,,,,{{(((,,,(((((((,{{,,((({{{..(((((,{,.{((,,........,||||||,,.{||||||{|||((((,({{(,,(((((,,,.{{{{..,..|}}},{{{{{{...{((,{..((((((....)))))).}.}}|,|||||{{{,{,.(((((((.(((..(((..{((((((((((......,,(({{((({,,,({{,....||...{|||.{,|||{{{{....{((((((,..{{{,.,,,.,...,,.(((((.((((.({{...))))))).))))}.,},,.(((((((.....))).)))).{{|||,..,}}}}.,.....,,...,}}}},........(((((((.......(((((((((((..(..(((((.{.({..,{((((..,,,{(((((((.....))))))),{{||,},,)))}}...............}}}))).}.))))))..)))))))))))(((((....))))).((((((((({{.......}}.)))))))))....,|,.....,.)))))))..,}}}}}},.)))}.,}}))))}.))))))))))))))),))}}.)))))).))))))).,||{,||||||}..}||},|||,,,.,||||..,,,{{{,,{{,,..|}}.}||||}||{,....,{((((((.,,{{{,,,|||{|.(((({...}))))....,.....}}}}.,.,,}}|||{||||{,,.{{{,....,,}}((({{{{,{{{{{|||{..|{||,,.(((((.....)))))......|{{....,,,,)}}((((((((((..........(((((.((((((..,..((((((..((((.((...(((((({...}))))))..{,,((...)))}..(((((......))))).)).))))..)))))),..))))).).)))))............))))))..)))).,||||.|,,,{((((((.{..({{{.((((.(((((((((....(((((.(((((((...,...((((..{{.....{((((((((,{{{,..|||,..))}.}||||}}}}}}},,,)}.)))).((((((((((.((.(.((((...(((((...........},,))))).))))).))..)))))))))).....))))))).))))).{{,......,}).....))))).)))).))))....}))).)))))))).)})))),)})))),},,.,}}}},,{..|||||}}},,).,,,},.)))}...}}}}))).....))}})))),}})))))},|},{{|.{|||{{|||,,,..)))).{((((({..((((..(((.............)))..)))}.})))))}||}},.,,},.......{(((((((((((((.(({((,{,((((.((((((((((...(((((((((((((((({.((((..{{(((..,(,(((,{{{,..|}|{{|}}||.{{{....{{{{,........|||||,|{||{||,...,})}||{{|.,...((((((.(((((.,{{...((((((.((,....(((((.....)))))..)),))))))(((.(({{...,),)).).))...,,,))))).))))))...,})})))),(((((((((((((.,,{..,.....))}....)))),......((((.(((((((((((((((({{{,{(((({.....,,..|||||,...,..,,{{{{.............(((((((.....((((((..,.(((((((((((....(((....))).....))))..))))))).}..,.((((((((((,(,...,),))))),})))).....,))))......)))))))..,|{{({{{{{(({(((((,...})})))}))).)))))}||.(((((((........))}})))).),,))))}}))))...)))))))).))))....,,,.|{(((((,,.}}||}.(((((,({.(((,{{((......))))))},||}}}}},.|.{((((.(.(((((.(....).))))).).))))).,.,}.,}}}|.((((...)))).|,.((((((.....(({((({{{{,{{,.((((((((,,(((|{({.{(,{{,.....{((((({{|{(......}}),})))))))(((((({...})))))).,||||||{..,,,,.....(((((((((({,({.,....,,||,.,.....((((({...}))))}((((((((.....)))))))),{{....,,,,.........,,.....}},.((((..(((((....).)))))))}.((((((((((...{{,,..,{(((.{{,{..,,},)},|||},..))},((((((..........)))))).,.....))))))))))...,)))))))}),}}}}}}}...,.}})))))),,{(({((.,,.|||||,,{{.,,,}}}}))).))),},.))}))).,))))){,,(,(,,{{.({((,,......{||||,..})))),,...)}}).}},,}))||,.,}))))}}}})))))))).....{(((,..,{{{..........}}})))))........}}}}||}}},..}}}.......)))).})))))).)))))))).))...)))))))))).)))},,,....{(((..((.(((((((....))))))).))..)))},,(({{(({{{{{|{{{{{......))),)))})|||||||||}|||}.{|||,,{{,...|||||{,..,||}}}..}}}}.)))}}))}..})),..,,)),,,|||.,,,,}}}...}}})}))).....,.....{((((.((.((((((((.{{{.(((((((((..(((((.....(((((....(((({.,.(((((((((...)))))))))..}))))....))))))))))..))))))))).)}}..)))))))))).))))}.))))))))),...(((((,{,..{((((((.(((((((..((((((((((((((..((((({....}))))).............))))))))))))))..))))))).)).))))}.....{{{{{{((......)))))))),},,,)))))..,}}},,,,,|,,|||||||},|,|},..,,|{|||,,|||||,}|||,..|{|||||,,|||||}}}}}}}}},))))).)))||,|||{{{.|,|{{|||....))}}}}......)))))))),,))))))}.

Transcripts

ID Sequence Length GC content
GCGCCGCUCCAGGCGGCAUCGCAGGGCUGGGCCGGCGCGGCCUGGGGAC… 3826 nt 0.4300
Summary

This gene encodes a class III receptor tyrosine kinase that regulates hematopoiesis. This receptor is activated by binding of the fms-related tyrosine kinase 3 ligand to the extracellular domain, which induces homodimer formation in the plasma membrane leading to autophosphorylation of the receptor. The activated receptor kinase subsequently phosphorylates and activates multiple cytoplasmic effector molecules in pathways involved in apoptosis, proliferation, and differentiation of hematopoietic cells in bone marrow. Mutations that result in the constitutive activation of this receptor result in acute myeloid leukemia and acute lymphoblastic leukemia. [provided by RefSeq, Jan 2015] CIViC Summary for FLT3 Gene FLT3 is an important cytokine receptor involved in normal hematopoiesis. Mutations in this gene are common in acute myeloid leukemia (AML) and screening for mutations in this gene has been recommended by the World Health Organization in patients with AML, particularly in cases of cytogenetically normal AML (CN-AML). FLT3 mutations commonly co-occur with mutations such as NPM1 that are associated with CN-AML and likely modulate prognostic impact. While FLT3-ITD mutations have been associated with poorer prognosis in AML, the prognostic impact of FLT3-TKD mutations are still up for debate.

Forensic Context

No relevant information is available at the moment.