| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACAACUUUUUUUCCUUAGUCUGUAUACUUUCUGCUGUCACUAGCAUA… | 2303 nt | 0.4160 |
Metabolic N-oxidation of diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man. This results in a small subpopulation with reduced TMA N-oxidation capacity and causes fish odor syndrome (Trimethylaminuria). Three forms of the enzyme are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. [provided by RefSeq, Jan 2015]
A study in rats demonstrated that the FMO4 mRNA, a marker for oxidative stress, showed no significant change after a 5 psi blast exposure but was part of an upregulation battery at 24 hours after a 10-11 psi blast exposure and was upregulated at 72 hours after a 14-15 psi blast exposure [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001]. A study in rats demonstrated that the FMO4 was identified as a specific mRNA marker defining the PI16+/FMO2+ fibroblast subcluster FB3 within the human corpus cavernosum, where single-cell transcriptome analysis revealed its role in cellular heterogeneity and signaling networks [Zhao et al. DOI:10.1038/s41467-022-31950-9].