Basic Information

Symbol
FMO4
RNA class
mRNA
Alias
Flavin Containing Dimethylaniline Monoxygenase 4 FMO2 Dimethylaniline Monooxygenase [N-Oxide-Forming] 4 Hepatic Flavin-Containing Monooxygenase 4 Flavin Containing Monooxygenase 4 Dimethylaniline Oxidase 4 EC 1.14.13.8 FMO 4
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_002022.3
Sequence length
2303.0 nt
GC content
0.4160

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-616.20 kcal/mol
Thermodynamic ensemble
Free energy: -663.82 kcal/mol
Frequency: 0.0000
Diversity: 607.67
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..............((...(((((((((..(((((.(((.....)))...)))))((((((((.....))))))))..(((((((..(((((....)))))...............((((((...))))))(((((...((((.((((((((((((....))))))).........(((.(((((((.((.......)).))))))).)))..((((((((.((.......)))))))))).((((((((((((((((..(((((((.((....)).)))))))......(((....))).))))))))((((((.((((((((.(((((.....))))).........((((........)))).....))))).)))..))))))((((....(((((((((((((((.((((.(.((((((((...(((((((.....)).))))).)))).))....))))))).))))).......((....)).((((((((((..(........)..))))))))))((((((((((((..((((((..((((((((.((((((....(((....))).......))))))))))))))..........(.((((..(((((((((((((...)))))))....))))))..)))).).......(((((.((((..((..((.(((((.....)))))....))..))..)))).)))))....(((((.....).))))...(((..((((.(((((.(.(((((....((((((((((((((((.....(.(((.(((...)))))).)....))))))...((((((((((((.....(((.(((((..(((((((((((...(((((((..........(((......)))..........))))......)))..)))))))))))((((......)))).))))).)))..(((((((.((((((((((((..(((.((((((((((((((..(((.(((((((((((....((((......))))))))))))))).)))..)).(((((...(((..((((((..........))))))..)))))))).)))).)))))))).)))...).))).)))))).)))))))))(((((.(((((((((((..(((((((.....)))))))..((((((((((((((.(((((......((((((((...(((...((((((......)))))).))).....(((((((((((((((.(((((((..((.....))..)))))))..))))))))....(((((((((((.......)))))))))))............(((.((((...)))).))))))))))....((((((..........))))))..........((...((((...((((.....)))).)))).)).....))))))))......((((((.(((.((((..(((.....((((.....))))......((((((((......(((.....)))........))))))))(((.((((.........)))))))......((((((((.(((...)))..)))))))).((((((.(((((.(((((((((....(((.(((((...........((((((......)))).))))))).))).....)))))....))))..(((((.((..(((((...(((.(((((((((((.(((....)))...))))..))..))))).)))..)))))..))))))).))))).))))))..((((...))))..)))..))))((((((...........))))))......((((((((((.......................(((((......))))).........(((((((..(.(.............).)..))))))).)))))))))))))))))))..))))))))))).))))))))))))))))))).))))).............)))))...)))))))((((.((.((.....))..)).)))).(((((......))).))((((...(((((.(..(((((.............)))))))))))...)))))))))).))))....)))))).))))).))))..))))))))).))))..)))))))).))))))))))...))))..))))))))))))).))))...)))))...............(((..........)))..)))))))((....)).........)))))).)))..))....
Thermodynamic Ensemble Prediction
..........,,,.((,,.((((({{{,.,{({(({((,...,,))).,.}))}}|||{|({(,,{{{|||||,,,..{{{((({,,,|||{.},}})))}}},,..{{{({{(.(((((((...))))))).})},.|||{{,,{{{,(((((({....})))))).........{((.(((((((.((.......}),))))))).))}..((((((((.((......,,,))))))))..(({.....,|||,....(((((((.((....)).)))))))......,{{,,..},}.}}|||{{{((,,,,..((((((,..,||}}}}..,,,,..}}}}}.,,{{{{........)))),....|}|||||,,.,||||}|,({{{{{.{{{{.,,{{(((((,.(({({(,{,(((((({{{{{(({{,.....}).)}))).)))).)).{{{||,},,,.)))}}{(((({({{((,((((,{((((((,,.,({{{{..,.}..}},)))))),((((((((((((..((((((..{(((((((.((((((..,,{({....}}}...},}}))))))))))))))....,{,...{.((((..(((((((((((((...)))))))....))))))..)))),,..}},..(((((.((((..((..((.(((((.....)))))....})..))..)))).)))))....(((({.....|.))))...(({..((((.(((((.(.(((((.,..((((((((((((((((.....(.(((.{{{...}}}))).)....))))))...((((((((((((..,,{(({.{{{((,,((((((((((,.{(((,((({.....,....(((......)))..........}}}}....,,)})}))))))))))))|||(,,.,||,}},.})))},))},.,|})}|,.,{((((((((({.,(((.((((((((((((((..(((.(((((((((((....((((......}}))))))))))))),)))..)),(((((...(((.,((((((.,......}.))))))..)))))))}.)))).)))))))).)))...}}})).)))))).||{{(({..(((((.(((((((((((..(((((((.....)))))))..((((((((((((({{(((((......((((((((...(((...((((((.....,)))))).))}.....(((((((((((((((.(((((((..((.....))..)))))))..))))))))....(((((((((((.......))))))))))).}...,......{{{.((({...)))).}}))))))))....{{{{{{.......,,,}||||...,,,,.,,,{{...((((...(((({...,}))).)))).)}.....))))))))......{(((((.(((,.....,{(,.....((((.....}||}.....,(({{{{{{,,....|||.....|}|...,,...)))|||||{{.{((((.......,.)))))}}......((((((((.((,...,))..)))))))).((((((.(((((.(((((((((....(((.(((((...........{{((({......)))).}}))))).))).....)))))....))))..(((((.((..(((((...(((.(((((((((((.(((....)))...))))..))..))))).)))..)))))..))))))).))))).))))))..((({...))))..|||....,|((((((...,.....},)))))))}.,}}|(((((((((....,,{{.....,,,.......(((((,.....))))).........(((((((..(.,.............}.}..))))))}.)))))))))))))))))))..)))))))))))}}}))))))))))))))))).))))).,}))}..,,,..))))}..,))))))){(((.({.{|.....,}..)).)))).,,{{{......}}}.,,((((...((({{,(..{((((.............))))))))))).,.)))))))))).))))..,.)))))).))))).))))..))))))))).))))},}))}))))........,..,,,,}}})))),,)}},.))).}...,})))})}})}}))),.,})))))))},)}}}}..,.})},.})))}))|.,{{,{.....,,,,.}}}}}}.))},,)),...

Transcripts

ID Sequence Length GC content
ACACAACUUUUUUUCCUUAGUCUGUAUACUUUCUGCUGUCACUAGCAUA… 2303 nt 0.4160
Summary

Metabolic N-oxidation of diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man. This results in a small subpopulation with reduced TMA N-oxidation capacity and causes fish odor syndrome (Trimethylaminuria). Three forms of the enzyme are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. [provided by RefSeq, Jan 2015]

Forensic Context

A study in rats demonstrated that the FMO4 mRNA, a marker for oxidative stress, showed no significant change after a 5 psi blast exposure but was part of an upregulation battery at 24 hours after a 10-11 psi blast exposure and was upregulated at 72 hours after a 14-15 psi blast exposure [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001]. A study in rats demonstrated that the FMO4 was identified as a specific mRNA marker defining the PI16+/FMO2+ fibroblast subcluster FB3 within the human corpus cavernosum, where single-cell transcriptome analysis revealed its role in cellular heterogeneity and signaling networks [Zhao et al. DOI:10.1038/s41467-022-31950-9].