Basic Information

Symbol
FMOD
RNA class
mRNA
Alias
Fibromodulin SLRR2E Keratan Sulfate Proteoglycan Fibromodulin Collagen-Binding 59 KDa Protein KSPG Fibromodulin FM Epididymis Secretory Sperm Binding Protein Fibromodulin Proteoglycan
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_002023.5
Sequence length
2943.0 nt
GC content
0.5335

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1024.70 kcal/mol
Thermodynamic ensemble
Free energy: -1081.86 kcal/mol
Frequency: 0.0000
Diversity: 681.43
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((.(((((((((......................))))))..))).))))))...(((((((((((((((...))))....))))).......((((.((.....))..)))).(((((((((((.......(((((((..((((((((.((.(((.((((.((...((((((...))))))..((((.((.((((((...((..((((..................))))..)).............(((((...)))))(((((.((((((.............)))))).)))))...............)))))).....))..)))).(((((((((...........(((((.(((..(((((...))))).....((((((.....((((((.(......).)))))).....))))))...................(((.....))).(((((........)))))))).)))))..((((.(((((......)))))))))((((....))))..))))))))))).)))).))).)).)))).))).)..)))))))..(((...(((((....((.((......)).))...)))))..)))...(((((.((((((((......))).............))))).))))).........((...(((((((((((((((..(((((((.......(((.........)))...(((((.(((((((((.((((.(((.((((((((...........(((.......)))...........)))).)))).))).)))))))))))...))))))).(((((((((((((.((((.......(.((....(((((((..............)))))))....))))))).))))))))))))).........(((((.((((....(((((((..................))))..)))...))).).)))))...(((....(((((.((((((((......................((((((((.((....(((.........))).....)))))))))).......)))))))).).))))))).)))))))..))))))).((.(((((((((((((.(((.((....))...))).)))))))))).)))..))......))))))))....)))))))))))))(((...))).((((((.((((((((.....((((..((((((...(((((..(.(((((.((((((((((.(((((((((((((((.((((...((((((.(((((((.(.(((.(.((((((.(((..((((((................((((((((((.(((((((((..(((((((((((((((((((((((.........))))))))............((((((.((((((((.(((...(((((..(((....))).))))))))))))....((((..(((((((((((((.....((((((...)))))))))))))...))).))).))))....(((((......))))).)))).....)))))))))))))))......).)))))..)))))))))..(((((((((.((..(((.....((((((((.........((((((((((((.......((((((((((((((((.((((((...(((..(((((((................(((((((.((...((((((((.....(.(((....))))..)))))))).)))))))))..(((((...(((((.......)))))...)).))).))))))).)))...))))))...........((((((..(((((....((((.......))))....)))))((.((((((((.........)))))..))).)).))))))....((((.......))))......((((((......))))))..)))))))))))))...(((((((..........))))))).(((.((((......)))).))).((((..((....)).))))(((((............))))).)))))))).)))))))))))).)))..))).)).))))))))).....((..........))))))))))))((((.(((((......))))).))))....((((((((((((((.....((((((((((((((..((((...((((((((((..(((.....))).(((.(((((((((.((((((((.(((..(((((((((((((((......((((.((...(((.((.....)).)))....)).))))..)))..))))....)))).))))..))).)))))))).))...((((((..(((((((.......)))))))..))))))........))))))).))).....((((((((((....((..(((.......)))..))...)))))))))).(((((((.........))))))).......(((((....)))))(((......))).)))))...))))).))))..))))))).(.(((((((((((....((((...((((.((....)).)))).))))...........))))))))))).)((((......)))))))))))))))))))))).))).(((((....)))))))))))..))).)))))).))))).))).))))..)))))).))))))))))))))))))).))))).........)))))..))))).))))))....))))))..)))))))))))).))))))..((....)).......(((((((((((.(((........((((......))))))))))))).))))).......))))))....((((((...))))))...
Thermodynamic Ensemble Prediction
..{(({(({(,(((.((((,,,.....{,,.....,,...,)))))..))).)))))),..(((((({(((({,{..,,|,,,.,,,))))).......((((,((,......}})}))}||{((((((({.......(((((((,{((((((((.((.(((.((((.((...((((((...))))))..((((.((.((((((,.........{.,,...............||||.{.,...}}}}.,....,,,,,..{||||.(((((.((((((.............)))))).))))).}}}}},......|.)))))).....))..)))).(((((((((...........,(({,.,((,{(((({...})))}.....{{||||.,},,{{{{((.(......}.}}|}}},..,.})))))...,..,....{((.{.(((((.....))},)).)|}},,}...,}))|,,,,}},{|.(((((.(((((......)))))))))).|}.,.})),...))))))))))).)))).))).)).)))).))).}}})))))))..|,...,({,,{....|{.,,.{,,,,||.,,.},))))),}})}}..{,.,,,(({{(((({,,,.,,,,{{{{,{,,{{{{{|,|||,|||}}.........{{,{,((((({(((((((((..(((((((,,{({..{{{,,.......}}}...(((({.({((((((,,((((.(((.((((((((...........(((.,.....)))...........)))),}))).))).))))))))))).,.}}))))).(((((((((((((.((((.......{,,.....{(((((((..,,...,,..}}))))})}.....)})))).))))))))))))).........((({{.(({{....{{{{(((..................))))..))),..}}).).})))).,,{{{....,,{({{(({(((((.,.......{{,..,,,.....((((((({,((....(((.........))).....))))))))))...||||}}})))),.,.)))))))})))))))..))))))).||.(((((((((((((.(((.((....))...))).)))))))))).)))..||....,,||}}}}}|{{{,|.||||||||||}(((...}}}.,{||||.||{{||||},..||||,..||||||,},|{{||}}|}|{|||,||{|||,|||}|((((((((((((((.((((...((((((.(((((((.{.(((.(.((((((.(((..(((((({{((...{({{{((((((((((((({.(((((((((..(((((..({((,,,||(((((((.........)))))))|{{(((......(((((((.,{,.((((.(((...(((((.,{((....))).))))))))))))....{{((..{({{(((((((((.....((((((...)))))))))))))...})).}}}.))}}....(((((......))))).}},,.....)))))))..,...)))})).}..)))))..)))))))))..(((((((((.((..(((.....((((((((.........((((((((((((.......,,,{((((((((((((.((((((...(((..(((((((......,.........(((((({,((...,(((((((..,..{.(((....))),..)))))))}.)))))))))..{{{{{...{||||,|.....}}}}}..,)).})}.))))))).)))...)))))).....{{{...((((((..(((((....((((.......))))....))))),{.((((((((,,,......))))}..))).,}.)))))),,,.((((.......)))).....,,,,{{{,,,...}}}}}...))))))))))))}((((((((((.,........)))))))})))...,({{,...,.,|{||..,,,,.,||..,,)).}}})((({{............}})))}}}})))))}}})))))))))).)))..))).)).)))))))))....{((..........))))))))))}((((....))))..{{(((.{(.((,{{..{(((((((,.....,.}))))).}},,.|},)},}})))}}.......)))))))}}..}}}},...{((.(((((((((.((((((((.(((..((((((((,{(((({....,,(({(,(({..{{,.{{,,,.,)),}}},{{{||.,}},.,)))},,}))},..)))).))))..))).)))))))).))...((((((..(((((((.......)))))))..))))))........))))))).))}......,{(({,,,..,||||,,{|,|||||||||||,.(({,{{,{{{,{((,(((((((.,.......)))))))..,,,,.(((((....))))),,(((({..(((((((((((...))))}})),,)))...)))))((((((((((....((((...((((.((....)).)))).))))..,.....},,)))))))))))}}|{{{......}))},})))),},))},}))))})}}|{((({....)))))))))))..))).)))))).))))).))).))))..)))))).))))))))))))))))))|{||}}|.........))))},.))})}.,|||||,.,,,}}}})},))))))})))))})))))}..{{....)).,||,..((((((((((({(({....,,..((((......))))}},)))))).))))).......))))))....{{{,{{,..,}}}}....

Transcripts

ID Sequence Length GC content
ACUCCUCUCUCUCUUCCUCUCUCACACGUUCUCCAACCCAAGGAGGCCA… 2943 nt 0.5335
Summary

Fibromodulin belongs to the family of small interstitial proteoglycans. The encoded protein possesses a central region containing leucine-rich repeats with 4 keratan sulfate chains, flanked by terminal domains containing disulphide bonds. Owing to the interaction with type I and type II collagen fibrils and in vitro inhibition of fibrillogenesis, the encoded protein may play a role in the assembly of extracellular matrix. It may also regulate TGF-beta activities by sequestering TGF-beta into the extracellular matrix. Sequence variations in this gene may be associated with the pathogenesis of high myopia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]

Forensic Context

A study in humans demonstrated that transcriptomic profiling of left ventricular myocardium from autopsy-defined arrhythmic sudden deaths revealed 31 up-regulated and 36 down-regulated genes compared to nonarrhythmic deaths [Caudal et al. DOI:10.1016/j.jacep.2024.08.013].