Basic Information

Symbol
FOS
RNA class
mRNA
Alias
Fos Proto-Oncogene, AP-1 Transcription Factor Subunit C-Fos AP-1 FBJ Murine Osteosarcoma Viral Oncogene Homolog Transcription Factor AP-1 Subunit C-Fos G0/G1 Switch Regulatory Protein 7 Proto-Oncogene C-Fos Protein C-Fos FBJ Murine Osteosarcoma Viral (V-Fos) Oncogene Homolog (Oncogene FOS) V-Fos FBJ Murine Osteosarcoma Viral Oncogene Homolog Fos Proto-Oncogene, AP-1 Trancription Factor Subunit Cellular Oncogene C-Fos Cellular Oncogene Fos Activator Protein 1 G0S7 P55
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Mechanical injury analysis

MANE select

Transcript ID
NM_005252.4
Sequence length
2104.0 nt
GC content
0.5276

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-722.90 kcal/mol
Thermodynamic ensemble
Free energy: -764.10 kcal/mol
Frequency: 0.0000
Diversity: 539.98
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((((...(((((((((((((((((.((((((((((((.((.((.((((((((.((......)).))).)))))..))...)).))))((((....)))).....((((.((((((.....((((((((((..(((((((...........((((((((.((((....((......))...))))))))))))...((((((((((((.(((..((((((.(((((..(..((((................).)))..)..))))).)).))))..)))))).......((((.....)))).(((((.(((.((....(((((((..............)).)))))......)).))))))))...)))))))))..((((.....))))((((((((((.(((((.(...((((((.((((...((((.........(((((....(((((.......)))))..)))))))))))))..)))))).).)))))..)))))).)))).)))))))...)))..)))))))..))))))))))((((((((((((((((((((...((((((((.....((((((((((.......((.(((.((.....)).))).))((((.(((((((((.(((((...((((....))))((((((.................((((((...)))))).((..((((...(((.....)))...((((..(((....)))..))))(((((.((...)).))))).))))..)).........(((((...))))).......)))))).(((...((((((((.(((((((((..(((((.((((.((.....))....(((((((((.........)))..))))))..))))))).))....)))))))))))).....)))))))))))))))))..((.(((........))))).........))))).))))..((((.(((((((((...((((((...((((((..(((...((((((....((((((....)))))).(((((((.((((.(((((((....(((((((.((((((..((...((.((((...)))).))...)))))))).)))))))....(((....)))....)))))))))))..((((...((((((((..(((.............)))(((((.((((((((((((((....)))))(((..((((.(((((((((((((..(((((.............)))))))).......)))))).))))))))..)))...)))))))))...)))))(((((......)))))...((((((((((((((((((((((((((.........((((((((...(((((......))))))))))))))))).)))))).))).....))))).))).)))))...((((((((((..((((....))))....)))))))))).........))))))))))))....)))))))((((.(((((....))))))))).........))))))...))).)).)))))))))))))))))))..)))).))))))))))))))))))..))))))..(((......)))...((((((..(((((...((......))..(((((((((((.........)))))))))))..((((((..((((...((((.(((.......))).)))).))))..)))))).)))))))))))...........((((......)))).)))))))).))))))........(((((((.........)))))))...((((((((...(((.(((..(((....)))))).)))....)))))))).))))).(((((....)))))(((.((((((...))))))))).........(((((((......)))))))))).))))))))).......(((((((((.((((((((((((......(((....)))..)))))))).))))..)))))))))...((((((.....))))))..))))...(((...)))...............)))).))))).
Thermodynamic Ensemble Prediction
...(((((...({({{{{|(((((((({.(((,{,{,((((.((.((.((((((((.((......)).))).)))))..))...)).)))),(({....}))}.,...((((((((((...((((((((((..((((..((((...........(((((((,,((((,,,.,,......),,..)))))))))))).....((((((((|{,{{((((((....)))))).))|,.(((((.{.((,{{...((((...(((((((((((((..(((((((((.((({,(..(((((...,,....(((({,(((.((....(((((((..............)).)))))......)).))))))))}.))))).))))).)))).)))))((.((((((((((.(((((.,.,.((((((.((({.,,{{,,..,,,,...(((((....(((((.......)))))..)))))))))))))..)))))).).)))))..))))))}}))).))...))..))).)))))))),...))))...,,,..(((((.................))))).(((....)))..)),.))))).,))))))))........))))))))..))))).)))))..{........,..))))))))))..,.(((((((((((({..((((((...))))))....(((((({....((({(((((((((((.{({..((((..{{{{{.((({(,((,..|}.|||||{{{.,{.{{.((({,{.{((((({,,|||||{{{,{{,,{{{{.{({,{|,{{,{,{||.,{{{||(((,.{{{||,|||{|||.,,,,||.{{{(((((((({,........)}}}}}))))}..)))))|||}}....},})))))})),..,|||}}||,{{,{{{|{,(({{({,((||,..,{,{{{{{|,,|(({{,,...{{{....}})},}}}||{{|||{..,{|||||,..||{|||,,||||||{({{(({...((((((....)))))).,}|.,((,((((.(((((((....(((((((.((((((..((...((.((((...)))).))...)))))))).)))))))...,{{{,...})),,..)))))))))))..|||{...{((((,,{,..{{,.............|}||{{||(((((((((,{(((....))))|(((.,({({{(((((((((({({..(((((...,....,,...)})))))),......))))))}}))))})).}))))),))))))))).{{|||}}(((((......))))).,,|||{,((((((((((((((((({(((.........(((((((({,.{((({......})))))))))))))))}.)))))).))).....)))))}})),))))),,,((((((((((..{{{(,,...,})},,.))))))))))..,,,,...)))))})}}|||..,,}|||||||||{}|{{||,...)))})}))),)))}.},,))}))},..})),)}.))})))))}}})))})))),,)}},))))})).))))))))))))))...{{{{(((.{{,....}}}))}},))|,,.{{{.(((((((((..((,{((((((((((.........))))))))))))).))))))))},}}}||{....||,,...}))))))|{((({{{,{..((((..{{({......})}}.))))....}}))))..,))))))))))))).,..,,{,,...{,(({((((.....,,,,)))}))),}}{(((((((...(((.(((..({{....))}))).)))....))))))))}))})},{,,,{,,..|||,|{{{.((((((...))))))},..,,.,}}..(((((((......)))))))))).})))))))).......(((((((((.((((((((((((......(((....)))..)))))))}.)))}..)))))))))...{(((((.....)))))}.{{{|.,,.|||..,}|},,,,...}},..,..)))),))))).

Transcripts

ID Sequence Length GC content
AACCGCAUCUGCAGCGAGCAUCUGAGAAGCCAAGACUGAGCCGGCGGCC… 2104 nt 0.5276
Summary

The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. In some cases, expression of the FOS gene has also been associated with apoptotic cell death. [provided by RefSeq, Jul 2008] CIViC Summary for FOS Gene

Forensic Context

A study in mice demonstrated that a single high-dose chlorpromazine administration induced the FOS in the heart, but this induction was not observed after repeated administration, with expression significantly decreased following repeated high-dose treatment compared to single administration [Sakai et al. DOI:10.1016/J.Legalmed.2010.07.005]. In adult rats, the FOS mRNA was transiently expressed in corneal and lens epithelial cells following ocular blunt trauma, indicating cellular activation without apparent direct injury [Shirai et al. DOI:10.1016/j.jcrs.2004.10.069]. A study in Wistar rats demonstrated that the FOS mRNA expression in iliopsoas muscle was significantly increased specifically in moderate and severe hypothermia models compared to controls, identifying it as a potential marker for hypothermia severity [Umehara et al. DOI:10.1007/s00414-018-1888-3].