| ID | Sequence | Length | GC content |
|---|---|---|---|
| AACCGCAUCUGCAGCGAGCAUCUGAGAAGCCAAGACUGAGCCGGCGGCC… | 2104 nt | 0.5276 |
The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. In some cases, expression of the FOS gene has also been associated with apoptotic cell death. [provided by RefSeq, Jul 2008] CIViC Summary for FOS Gene
A study in mice demonstrated that a single high-dose chlorpromazine administration induced the FOS in the heart, but this induction was not observed after repeated administration, with expression significantly decreased following repeated high-dose treatment compared to single administration [Sakai et al. DOI:10.1016/J.Legalmed.2010.07.005]. In adult rats, the FOS mRNA was transiently expressed in corneal and lens epithelial cells following ocular blunt trauma, indicating cellular activation without apparent direct injury [Shirai et al. DOI:10.1016/j.jcrs.2004.10.069]. A study in Wistar rats demonstrated that the FOS mRNA expression in iliopsoas muscle was significantly increased specifically in moderate and severe hypothermia models compared to controls, identifying it as a potential marker for hypothermia severity [Umehara et al. DOI:10.1007/s00414-018-1888-3].