Basic Information

Symbol
FOSL2
RNA class
mRNA
Alias
FOS Like 2, AP-1 Transcription Factor Subunit FRA2 Fos-Related Antigen 2 FOS Like Antigen 2 FLJ23306 FRA-2 FOS Like 2, AP-1 Trancription Factor Subunit ACED
Location (GRCh38)
Forensic tag(s)
Time since deposition estimation Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_005253.4
Sequence length
6713.0 nt
GC content
0.5334

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2554.20 kcal/mol
Thermodynamic ensemble
Free energy: -2670.18 kcal/mol
Frequency: 0.0000
Diversity: 1915.36
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((.(.........((((((..(((((((((((..((......))..).))))(((.(((..(((((.((.((((((((.....(((((.(((((((((((((((.(((((((((.(((..(((.((((((((((((.(.((((...((.((((((((((((((((((((((((((...((.(((((((.(((((..((((((((..(((((((.(((((...(((((.((.(((((((((........)))).)))))))((((((((((.((..(((.((((((((((((((..((((..(((((((((((........)))))))...))))(((((((((.....)))......((((((....))))))((((((....))))))(((((((...(((((..(((.(((((((...((((((...........))))))...))))).)).)))..))))))))))))..(((((((......................)))))))))))))(((((((((((((....))).)).)))))))).....(((((((.(..((......))..).).)))))).)))).)))).)))))))..)))))).....)).))))))))))))))).))))).)).......)))))..))))))))...((.((((((........)))))).))....))))))))))))))..(((..((((.......))))...)))..))))))).)))))(((.((((..(((.(.((..((((.(((.((.(((((((((.((((((((.(.((((.(((((.((((.........)))).))))).)))).).)))))).)).)))))).........((((((....(((....)))))))))))).)).))))))))).).)))..)))).))).....((((.(((((.(((((...((((.((((.((((.((((..((((.((((((((.((((..................((......))........((((.....(((((.((((..((.....))...)))))))))))))..(((((...(((((((((((((.....((((......))))((((((.......(((((((...(((((((((((((((.((((((((.(((((((.((((.(((...)))))))..(((((.(((.......(((.((((((.......)))))))))((((..(((((((............((((....))))....)))))))..))))(((.(.((((........)))).).))).(((((...((.(((((.((((((((.((((((......(((((.((..((((((((((....((.(((((((.(((.((((......((((.((((((((......)))).......)))))))).((((((((((((((((((((.(.(((((....))))).).))..))))))))).)))))((((((((....((((((((((((((((((.((.((((((........)))))).)).).)))))).((((.(((.....))).)))).....((((..(((((.(((.((((((((((......)))))))))))))..........((((......))))...))))).......))))........))).)).)))))).....))))))))((((((((((.((................)).))))))))))..))))...(((((..((((((.((.((((.....(((..........)))....)))).))))))))..)))))..........(((.((((((........))))))))).))))..))).)))))))))(((((...(((((......(((((((((((.(((.((..((.((((((((......(((((.((((((..(((((((((((((((((((...(((((....)))))........)))))))))..))))((((((((((.((((..(((...........(((..(((((...(((((...(((...)))...))).)).....)))))..)))...)))..))))..)))))))))))))))).))))))..))))).........)))))))).)).)).))).))).))))))))..)))))...)))))..........))).)))))))(((....))).)).)))))......))))))..)))))))).))))).)).))))).))))))))))))))).))))....))))((((....))))......)))))............((((((....)))))))))))(((((((.......))))))))))))....)))))))..(((((...((.((........)))))))))...((((.((((((((((((.((((((((((.(((..((.((....))))))).)))...))))))).)).....))))))))))))))((((....))))(((..(((((((((.....)))))))))...)))..))))))......)))))))))))))...))))))))).((((((((.(.....).))))))))((((((...((((((..((.......(((.....)))......))..)))))).....))))))).))))))).)))))))))))).)))).)))).)))))...))))).)))))))))).))))))))))(((((((....))))))).((((............))))...)))).).))))).))))))).))).(((((((.....)))))))..(((.....(((.(((....((((((.((..((((.((((((((....(((((...)))))((((((((..(((((.....(((....))).........))))).)))))))).)).)))))).((((((....))))))...(((((....))))).))))..))))))))....)))))).((((..........))))))).))).)))))))))...))))(((((.....)))))..(((......))).)))))))))))...))))))))))))).))..))))).))))))((((.(((((.((((((..((.((((.(((((......))))))))).)).)))))).)))..)).))))..))))))..)))))).........).)))))(((((.(((((((((((.((...(((.(((.(((...((((((((.((((......))))..(((((....)))))(((..((((....))))..)))..(((((((...)))))))..(((((((((..((((..(((((((.((((..(((.(((((((.(........))))))))))).........)))).))..((.(((((((((((........((.((((((((....)))))))).))..(((((((((..(((((((.(((((.(((((((..((((.((....))..))))..........((((((....(((((((((.....))))((.(((((((((((...((((....((((((((.....)))..))))).....))))....))).)))))))).)).)))))......))))))(((((...)))))..))))))).))((((.((((((((((((((.((((.(((.((((....)))).))).)))).))))..........))).))))))).))))((((.((.((((..(((((((((((..(((((((((...)))).)))))....).)))))))).))..)))).))))))..))).))))))).))))))))).)).))))))))).)).))))).))))..))).....))))))....)))))))).))))))...((((...(((.((((((((((((((((.(((((.....))))).)))).)).)))))))))).)))..))))))).))..)))))))))...........(((((((((...(((((((((((...))))))....(((((((((((((((......)))))))).((((((((......(((((((........)))))))............(((.(((((((......)))))))...)))....))))))))......((((((((((.(((((...((((((..((((((((((((((((.((.(((...)))...)).))))((((((((((((((((.(((((.....))))))))))))))).)))))).))))))((((((((((((((...(((.(((((((((.......((((((...(((((.(((...((((..(((((.((((((.(((.((...(((((.....(((((((((((((((....))))))))..(((((.(...).)))))..((((((((((((((.((((((((((.(((((((((((......)))))))).))).)))))))......)))....((((((....)))))).(((((((..((((((....))))))........((((...)))).))))))).((((((....))))))....(((((.....(.((((((((((((((((...............)))))).)))...))))))))....((((((..(((..........)))..))))))......))))).........(((((((((((.((((.((((((((.(((((((..(((((((((((((((((((.(((.(((((.............((((......))))..))))).))).((((((((((((((((.(((......))).)))((.((((((....)))))).)).........))))))).)))))).........(((((((((((((.((((...(((..((((((......).))))).)))....)))).)))......(((((....(((....))).......))))))))))))))))))))))).....(((((.((((...)))).)))))(((((((.(((((((((((((.......))....))))))))....))).)))))))))))))))).))..)).....))))).((((....)))).((((......)))).((((..((((((....))))))..))))))))))))))))..))))))..)))))((((((((((((((..((((((((((((..((((((((.((..((((......))))(((((((((..((.(((((.(......).))))).))..)))))))))......((((((((((((((((..((((((((.(((((((..((((......((........))....((((.(((..((((.............))))))).))))..........((((((..(.(((.((((((((((....))))))))))...))).)..)))))).))))..)).))))).))))))))....((((...(((((.((....(((((......))))))))))))...))))))))))))...((((((((.......))))....))))...)))))))).)).)))).)))).........))))))..))))))...)))))).((((((((....((((((((...((.....))...))))))))....))))))))))))))))..))))).)))))))))((((((.....................(((((((((..(((..........((((((((((((((.(((((..((((((.........(((((((((..((.(((((((((.((....)).)))))))..(((((.((..(((..((((((.........(((((.(((....))).)).))).)))))).))).)).)))))((((.(((((((.......(((...)))......)))))))))))................)))).)))))))))..))))))..))))).))))))))))))))...........)))..))))).))))))))))))))))).))))).)).))).).)))))................(((((((((.((........))))))))))))))))..)))).........))).)))))..))))))...))))))))).))).((((.....)))).....))))))..))))...))))..................))))))..........................((((.((.....))))))(((((.((((.......)))).))))).((......)).))))))...))))).)))))))))).((((.(((......))).))))(.((((.(((((((.(((..((((((.(((...((((((....((((.((((.....)))).))))....))))))...))).))))))..)))..)))))))..)))).)))).))))..(((((((...........)))))))..............))))).)))))))))..)).))))).((((((((......((((((((...))))))))......))))))))....
Thermodynamic Ensemble Prediction
,{{(({.{{{..,,..{{{{||,|{{{{((((((({,(({,.{{.,|(((((.{(......})..)))))|,.||{{{,((((((((((((.(((((((((((((.({{((((,{(,(((((((((.((((((((((((,{.(({{,||((,(((((((({(((((((((((((((((,..((.(((((((,(((((,.((((((((..(((((({.(((((...{((((.((.(((((((((,......,)))).)))))))((((((((((.((..(((.((((((((((((((..,{{{..,{{{((((((({({...})))))))),,,||||{,.{(((((.....)))})})}}((((((....}))))){(((((....)))))|(((,((({{.((,,,..||,}||||{{,..,(((((,({{.{{{{,,|||||||{{,|||||{||.,|.}}))})}},)))))||}}|.................||,|||},.))),))))),,}}(((((((((((((....))).)).))))))))))))}(((((((.{..((......))..).).)))))),)))).}))).)))))))..)))))).....)).))))))))))))))).))))).},......})))))..))))))))..{(({((((((........)))))).)),}},))))))))}))))),,(((..(((({......))),,,.))}..)))))),,)))))({(,(((({,(((.(,{,..({((.(((.((.{({({((((,{{((((((.{.((((.(((({.({,..,{....}))))).))))).)))).).)))))).}}.}))})).,,....,|((((({.,..,{.....,}})))))))}|.)).})))))}}}.},))}.|)))).)})....{((((.(((((.(((((,..((((.((((.((((.(((,.,((((.((((((((,((({..........,,......,{,.....,,..,.,,..((((.....(((((.((((..{{.....})...)))))))))))))..(((((...(((((((((((((.....((((......))))((((((..{(((((((((({...(((((,(((({((({{((((((((.((((((,.{(((.(({...})))))}.{(((((.(((..,,,,.{((.((((((....,,,)))))}}))((((..(((((({............((((,,..}}))}...)))))))..))))(((.(.((((........)))).).))).{{{{{...((.(((((.((((((((.((((((.({{,,({{({.{,..,||{{{||||,|.{((.((((({(,((({((((,.{{{{(((({((((((({{{,,.|,|{|{..,,..,|||||{{{((((((((((((((((((((.(.(((((....))))).).))..))))))))).)))))((((((((....((((((((((({((((({,((.((((((........)))))).}),|,)))}}|,((({.{({...,.|||,}}}|,,,{{((((.{((((...|}}|||||}}|,,..||||}||}|}||,,,,.,.........|{|(,,....}}}}.,,})})).,....,)))).}}},,..))).)).))))))..}..))))))))((((((((((.((................)).)))))))))).{|,,,.}}(((((..((((((.((.((((.....(((..,,.....,)))....)))).))))))))..))))).....,|.|.(((.((((((........))))))))).)}}},,))),)))}}}}.{{|||{...||{{{.|,..,|||{{{{||||,|||,|({,({,{(((((((..{.,.(((((.((((((..((((((((({{((((((((,,,(((({,,.,|||}}..,,.,..)))))))},..}))}|{||{|||||.||||..|||,}},,,.,,,..|||,|{{||{{{|||,}}||{{|.,.|||,,.,{|{||..,,||||||.,})},..})|..}}}},.|)))))})}})))))).))))))..)))))......,,.))))}}}}.)}.)).})).)}),)))))))),.))))),,,)))))),,}},}},.))),))))))}{{{....))),)).))))),},.,.))))))..)))))))).))))).)).))))).))))))))))))))).))))....))))},{{....}},,.,,}}.)))))............((((({....})))))}))))((({(({.,...,.})))))))))))}...}))))},..{|||}},{((.((........))))),,,,...((((.((((((((((((.(((((((,({.,,{.,,,.(({{{{|,,,)))})))...))))))).)).....))))))))))))))((({....})))(((..(((((((((.....)))))))))...)))..))))))......)))))))))))))...)))))}}}}.||||||{{.|.,...,.})}},,,|{(((((..,((((((..((......,{((....})})......))..)))))).....))))))),)}))))).)))))))))))).)))).)))).)})))...))))).)))))))))}.}))))))}}}(((((((....))))))).((((............))))..})))),),))))).))))))).})),(({({(({,,,||}|||||..,,}}|||.,,|||,......((((((.(.((((..((.{,{{{(((.((((((..(((((((,{{,,,.,((({(,,,{{((({{{{.||{{||{{|{{|||(({((((((((((({((({{(|{{||{{,,||))))))|,|({{((.,..)))))..,||{,}}})))|{|||,....,)))))},}.))))))}||((((((..(({....,))))))))..(((((.....)))))..{{{,,....||}|,,,,,,,,,...,.)))))}}))))}}.{((((((((({{.{{{((((.(((((.((((((..((.(((,,(((((......))))))))).)).)))))).))}..)).)))).....((|,(((((.(((.{{.,{{{({,,,)|||||.,((((,,(((,{((..{((,.,,..,,|}}{(((((((({((({......)))),,((((,,,,,,}}))|{({{{(((.{{{||,|{{{||{{(({,{{({{{|||||||..(((((((((..((((..(((((((.{(((..(((.(((((((.{........})))))))))).,.......}})).})).((.(((((((((({........((.((((((((....)))))))).))..(((((((((..(((((((.(((((.(((((((..{{{{.{{....},..)}}}..........((((((....(((((((((.....))))((.(((((((((((...((((....(((((({(,....})}.,))))).....))))....))).)))))))).)).)))))......))))))(((((...)))))..))))))).))((((.(((((((,{{((((,,({{,{,,.,,(({{..{|||.,,,,))),.)))).....}....)))}))))))).))))((({.((.((((..(((((((((((,.(((({{((|...)))).))))}....)})))))))).))..)))).))})))..))).))))))).))))))))).}).))))))))).)).))))).))))..))).....))))))....))))||||{|,|(({{..{(((.,.(((.((((((((((((((((.(((({.....))))).)))).)).)))))))))).)))..}})),||,{{..,,,,|}|||{{{....}}}}}}|,,,,,....||||,{,,{{{|||})|||||||}|,|}}.,||{{(((({{{{...||||,,,.((((((((......(((((((.{,...,})))))))............(((.(((((((......)))))))...)))....))))))))..}})}}|}}.||||.}|,|||}}}||||||..|||||||||{{{(,{(,|,.||{,..|||,,,||||||}((((((((((((((((((((((.....))))))))))))))).)))))).,|||||{.,,{||{||||{,....,,.{{{,,..||}},}}}}})}|||},,||||,}}}}}}}},,,............|}}.}}}.,)}}}}}}.})).)))))))).(((((((....))))))))}}.}}.))))))))))|||||||}}}|}}.,,|||}|,}|,....}})})))))|,|}}}.,,,,|}||||},}})||||||,.,,,,.}}}))}..))))))).))))))))))))}.))..)))).)..})))))||{...(((.((((...(((((((.......((((((((.,,(((({...(((((,,...(.((((((((((((((((.,..,........}.)))))).)))}..})))))))....((((((..(((..........)))..)))))),||,..)))}}......})))}|}||{,...{(((((........))))))})).,,,,))))))))))))))).)))).)))...,,.........,|||.,,}))))))))|{{{{(.((((((((((((..((((({((({,..{{||,{||||{.((((((....)))))).)}..,,....,,,))))....)))).,}}}}}}}}},..(((((((.((((.((((.(((....))}.{((((((..,..,.,...,||{|.,((((({{((((((...,(((....))).......)))))))))))).,,.,.,||||{{{..((((...))))..))}..(((.((((((((.((((((((((({{.......)),...})))))))....))).))))))))))),((((({..{(......)).....}))))).)))))}}.({{{{..,,,|.||||,.{(((({....))))))..}}}},,)))).)))))))))))....,||||((({{{{{{(((((..((((({((((((..((((((((.((..((((......)))).((((.{{,..||.}|))({{..{{{{{((|||,.,},.))))))),)},....((((((((((((((((..{((((((((((((.((..((((......((........))..,.((((.(((..((((.,,........,.))))))).)))),.........((((((..(.(((.((((((((((....))))))))))...))).)..)))))).))))..)).)))))})))))))}....((((...(((((.((....(((((......))))))))))))...))))))))))))...(({{((((.......))))....})))...)))))))).)).)))).)))).........)))))),.}))))),..)))))}|{(((((((....((((((((...{{.....}}...))))))))....))))))}}}}}}}}}}.,,))))))}..,))))).)).))))........}}}}.}),)))))))))}}))).))))))))))}|,{{{{{{{{{{{,,(((((,.{((({{....,},,}|||||{{|{..,,.,.(((((((.((....)).))))))}.{((((({({...{(((((((({{...{{{{{({(((.(((....))).)))|,{{{{{{.(({,((||{{{|||((||.(({,,,}}}...{{((({.{{{...{{.{{((({{(({.,,.(({{,..{{{..{{.,||.|,,,,,,}}..}),)),.})))))}),}},)))))))))}},}}.(((((......))))).))),))))))}})),}})}}))).))),,)))))),}{{{({{..{{{{{...(((((((((.((........))))))))))).)))),.,,,)}}}}}....,,|{{|{{|{.,,||,|{{{|||.||||,{{,...,...}}}})).,.))))))).}}..,))))))))))}}}}..,}}}}))))}.{(((.{({.{(({....,.,,{,.....})}.}}.,,.)))).})))))),{((((.((((.......)))).)))))}}))))))),{,|||{{|{{{|||,,..,.}))))))}...}},{{|||,.{||||,}}}})}}))}|||||||||{{|,||{{{{,{({...{{((((....((((.((((.....)))).))))....))))}}...))),})}))}{{(({{........)))))),))|}},,|||,||,,,,.........{{(((((((((({,,|{{.....,)))))))))))))))..,,.,,}}}|{(((((((......((((((((...))))))))......))))))))}},.

Transcripts

ID Sequence Length GC content
GUAGUGACUCAUCUCGGGCAGAGCGCUAGGGCUCCGAGCGAACCAGCGA… 6713 nt 0.5334
Summary

The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. [provided by RefSeq, Jul 2014]

Forensic Context

A study in humans demonstrated that the FOSL2 was included as a time-of-day prediction marker in a targeted RNA sequencing panel for bloodstains, where it had a coefficient in the final penalised regression model's sine component [Gosch et al. DOI:10.1101/2025.02.03.636230]. In rhesus macaques, RNA-Seq analysis of left ventricular tissue identified the FOSL2 as a differentially expressed gene that was upregulated in animals affected by hypertrophic cardiomyopathy [Rivas et al. DOI:10.1038/s41598-024-82770-4]. A study in mice demonstrated that the FOSL2 is an immediate early gene and a marker of biomechanical stress, with its mRNA expression significantly increased in the heart after a single high-dose chlorpromazine administration compared to almost all other treatments, but this induction was not observed after repeated administration [Sakai et al. DOI:10.1016/J.Legalmed.2010.07.005].