Basic Information

Symbol
FOXC1
RNA class
mRNA
Alias
Forkhead Box C1 FREAC3 FKHL7 IGDA IHG1 ARA Forkhead-Related Transcription Factor 3 Forkhead-Related Protein FKHL7 Forkhead Box Protein C1 FREAC-3 IRID1 Forkhead/Winged Helix-Like Transcription Factor 7 Forkhead, Drosophila, Homolog-Like 7 Forkhead-Related Activator 3 Forkhead Box C1 Protein Myeloid Factor-Delta ASGD3 RIEG3
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Other applications

MANE select

Transcript ID
NM_001453.3
Sequence length
3983.0 nt
GC content
0.5626

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1577.90 kcal/mol
Thermodynamic ensemble
Free energy: -1641.37 kcal/mol
Frequency: 0.0000
Diversity: 1034.07
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((...(((....(((((.........)))))))).)))((((((((.(((((((.(((.((..((((((.((((((((((((..((.(((((((.(..((((.(((((.((.(((((...........((((((.((((((...(((((((((.((((((.((((..(.((.((((((.((((((.((.((((((.((((.((((((((((..((((((((((((.(((...((((((.(..(((((...(((.(.((((((.(((.((...((((.(((...))))))).....))))).)))).)).).)))((((.((((.....)))).))))))))).).))))))))).))))..)))......((((((((((...((((((.(((..(((((.(((....(((..((((((((..((.(((..(((((.(((((........)))).).)))))..)))..)).)))))))).))).(((((((((..(((((.(((((.((((((((((((....((((((.((.(((((((.....(((((.((.((((..(((((...)))))(((((.....(((((((((..((((.((...((((((((((...))))((.((((((.(((((.....)))))...)))))).))....))).)))...))...)))))).)))))))..))))).)))))))))))..))))))).))))))))...))))((((((.((((((..((.(((((((((((.((..............)))))..)))))))).))...........(((((...(((((.......(((((((......)).)))))....(((.....))).))))).)))))..........))))))((......)).(((.((....(((.((((....((.((.((((.((.(((((((((((...........(((.......))).(((.(.(((.((((...(((..(((..(((...)))..)))..))))))).))).).))).)).)))))))))...)).)))).)).)))))))))....)).)))........)))))).((....)).)))))))))).))).)))))..)))))))))..((((.(((......))).))))...))).))))).))).)))))).)))).)))).))..)))))..))))..)))))))))).)))))).))(((((((..(((((((..((((((.(((((((.((((((((((.((((((.(((((.((.(........).)).)))...((....)).((((.((((((.(.(((......)))).)))))).)))))).)))))).))))))..))))((.((((((((...))))))))))(((.((((((.(((((((.((((((((((.((...(((.(((((((.(((((((............(((((((((((((..((((.((.(((((((((((((((...)))))((((....))))...)))))))))).)))).))((((((.......))))))((((....((((......))))..))))(((((........)))))))))))))))..))).)))).))).)).))))).)))))..)))))))))).))))))).)))))).)))..))))))))))))).........(((..((((((((...((.((((.(.(((.........))).).))))))))))))))..)))..)))))))..)))))))..(((.(.((......))).))))).))))...)))))).)).)..)))).))..))))...).))))))))..)))))).))))))))))).)).))))).))))..)..))))))).))..)))).))))........)))).))))))..((((......)))).(((((((((((((((((((....))).(((.(.(((((.((....)).))))).))))....(((((((((((.....((((..(((.((.(((((.((((((((((..........)))))))))).))))))).)))...)))).....)))))....))))))......))))...)))))))).))))...)))))..)))))))...))..((((((((.(((((((((((((((....(((((((((((((......((((((((((((((..(((((((......(((((((.........................................(((.((((((................))))))..)))..........((((....((....))...(((((((.....)))))))....((.....)).)))).........)))))))(((((.(((((((...........(((((((.....)))))))..........)))))))...)))))((((((.......))))))....)))))))...))))))......)))))))).........((((((((((.(((((((((((((.(((((((.(((.(.(((.((((......)))).)))).))).))).((((((((((..(((.(((((((((.(..............((((((((.(((((((((.(((((((((......)))))))))))))))...((((((.(((((((.((....(((((......))))).......))))))))).)))))).....((........))..((((((((........((((((((....(((.......)))....))).)))))......((((((((((..(((((...(((((((....)))))))...((((((...))))))((((......))))))))).)))))))))).............)))))))).((((((((((........((((........))))........))))))))))...((((.....))))))).))))))))................).)))).((((((((..((((((..((((((.((....((((..((.(((....)))))..))))...)).))).)))..))))))....))))))))(((((..(((((.....((((......)))).....)))))..))))))))))..)))..))))....(((((...((.((((((((.((((....)))).))).))).)).))...))))).(((((((........)))))))......((((((((((((((((.((........)).)))))))...............)))))))))((((((..((((......))))..))))))(((((...)))))((((((......))))))...................)))))).....(((((((((((((...)))).)))))))))((((((((((((((..((((((((((((........)))))))).....(((((((((....))))).))))))))......))))))))))))))..............)))).)))))))))))))((.((((....)))).))..(((((((((......)))))))))(((((((...((((((((.........(((((....((.....))...)))))...))))))))....))))))).(((((......)))))..((((((.....)))))).............))))))))))))))))).........)))))))))))))((((((..((((...((...((((((......)))))).))...)))).)))))).......(((((((....((((((....))))))...))))))).............))))))))..))))))))..................)))))).....
Thermodynamic Ensemble Prediction
(((...(((....(((((.........)))))}}}.)))((((({{{.(((((((.(((.({..((((((.((((((((((((..((.(((((((.{..((((.(((((.((.(((((...........((((((.((((((...(((((((((,(({{{{.{{((,,({{(,((((((.((({({,{..{|{|||,|||||||{||||||{..{{|||||...,...,{..,|||,((((|.{{(({((,({({((,,..{{..(({(({(.{({({(((((((({{{((({.{{{({{{,({.({{.{{{{(((((((((((((((,((({{{{{(|{.{{({{.||||{{{|.((.(((.(((({.(({.(((((((.....(({...,)})..)))).)))....)}}.).)))).))).}}.{{|||||||||}|||,...}}}.))))),||||||}||}}}}}}}|||}||||},}},.||||,}||((((((({(.(((({(((((((((((,.(((((((({.((({({.{{{({,((((.{{,{{.{{,,..,{{,,...)))))|}||||||,,{((((((((,{((,,.||}....,{((({((,{{},||(({(((((((((((({{.,,|||||{{{|||}|||,}.,{.|||{||,..|||...}))))),)))))}}..}}}...)))))}))}||{(((.,,,..)))))).....((((((.((((((({{{..((.(((((((((({{((..............)))))..)))))))).)).,,,,,...,.(((((...(((((.......(((((((......)).)))))....(({.....})).))))).)))))......{{{{(({,((((.({......)).))))...}}}{{{{,,...||||,,||||}|,.{|,(((({{{(,.(.....}..)}}},))..}))),.},.,,|||.((((...(((..(((..(({...}))..)))..))))))).}}))))))).))))))({{((((.....))))..))))))}..,},},.,|||{.,.,{....|,)}.|.}}},..},))))))))))}}.}))))))).))}})))))),))))))))),)})))))}.{({{..,,.)))))}})))).))))))))))||}|}}.,,,,)}))}..}}}|,,|}}}}))))},)))))})))|||||||}.|||||{({,((((({{(((((((.((((((((((.(((((({,(((({(({(........,.|({{{({{{((.({.,,.}}.),|)))|..,.|||.,}..,||,,.))))}}})})),).)))))).))))))..))))((.((((((((...))))))))))(((.(((((({(((((((,((((((((((.({...(((.((((({(.(((((((.........,..(((((((((((((..({(({((.(((((((((((((((...)))))((((....))))...)))))))))).)),))))((((((.......))))))((((....((((......)))).,))))(((((........)))))))))))))))..))).)))},))).}).))))).))))),,)))))))})),)}))))),)))))).)))..))))))))))))),,.......{((..{{||||,|...||.||||},.|||}}}},,}},)})))}))}}},))))))))},}}||,}))))))},)))))))}}|||}|,||..}}}}})}})),,)},,)),,.)}))}}.))})..)))).}),,))))...,.))))))))..)))))).))))))))))).)).))))).))))..}..))))))).))..)))).)))),.......}))).)))))),.{(({......}))},(((((((((((((((((((....))).(((.{.(((((.((....)).))))).})))....(((((((((((...,,((((..(((.((.(((((.((((((((((..........)))))))))).))))))).)))..,))),..,}.)))))....))))))......}}}},,,)))))))).))))...}))))..))))))),..}}..{(((((((.(((((((((((((((....((((((,,(((((,,....((((((((((((((..(((((((.....{(((((((...{.....................................(((.((((((...........,....))))))..)))..........((({....{{....}}...(((((((.....)))))))....||.....,,.|||}...,}}...)))))))|((((.(((((((...........(((((((.....)))))))..........)))))))...)))),((((((,....,.))))))....)))))))...)))))),.....}))))))).......,{((((((((((.(((((((((((((.((((((({({(((((((.,((({{..,,|,||,{.,..|||,|||{{(((((...})))),,,,,.(((((...))))){{{{,..(((((((({,(({{(((((.(((((((((......)))))))))}))))}...((((((.(((((((,((....(((((......))))).......}}))))))).)))))).....,,........||,{,,{{(({{,,......||||||{{|,.,{((,,.....|||.,,,|||.||,,|......,{((({((((,,,{{,,...||{||||,,..))}))},...((((({...})))))((((......))))}}}}}.,}}}}}}}}}..,,...,.....}}}}}}}},((((((((((........((((........))))........)))))))))}...{(((.....)))|(((........))),...........,|,|{,.{(((((((((..((((((..((((((.((....((((..((.(((....)))))..))))...)).))).)))..))))))....))))))))))..)}}{|||||,||,,,,,..,,,.)))}.,,,...,,,))))))))))))...})}}........(((((...((.((((((((.((((....)))).))).))).)).))...))))).(((((((........))))))).....,((((((((((((((((.((........)).)))))))}...,{{,....,}})))))))))|(((((..((((......))))..)))))|(((({...)))))|{{{||......}}}}}|..,{{,.....,,,....,}}}}.}.....(((((((((((((...)))).))))))))).......,,,}))))..))))))).})}.})),........,(((((({...((.((((((((({{{(((((...)))))..}}))))))))).)).)))))))......)))).)))))))))))))((.((((....}))).)).,(((((((((......))))))))}|((((((,,.((((((((........,((((,,...{{....})}...),))).,.)))))))),,,.})))))|.{,,,,......)))}},,|{{{{{,...,)))))).......,.....)))))))))),))))))},,......)))))))))))))((((((..((((...((...((((((......)))))).))...)))).))))))......,(((((((....(((((,...,))))))},,)}))))),,..,,}}.....}))))))}..)))))))}....,......,,,.,,.}))))).....

Transcripts

ID Sequence Length GC content
GCUCAAAAGUUCAGAAGUUUUCCCAAUGCUUCCUUAAGCGGCUGGCGCG… 3983 nt 0.5626
Summary

This gene belongs to the forkhead family of transcription factors which is characterized by a distinct DNA-binding forkhead domain. The specific function of this gene has not yet been determined; however, it has been shown to play a role in the regulation of embryonic and ocular development. Mutations in this gene cause various glaucoma phenotypes including primary congenital glaucoma, autosomal dominant iridogoniodysgenesis anomaly, and Axenfeld-Rieger anomaly. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans using single-cell and bulk RNA sequencing identified FOXC1 as a predicted transcriptional regulator of key hub proteins in cardiomyopathy, with an area under the curve of 0.683 in receiver operating characteristic analysis, indicating its diagnostic and prognostic potential [Rahman et al. DOI:10.1038/s41598-024-78011-3]. A study in mice demonstrated that the FOXC1 mRNA was up-regulated 2.69-fold in bone marrow cells 6 hours after 6.5 Gy whole-body ionizing radiation [Dai et al. DOI:10.1080/09553000600857389].