Basic Information

Symbol
FOXF1
RNA class
mRNA
Alias
Forkhead Box F1 FREAC1 FKHL5 Forkhead-Related Transcription Factor 1 Forkhead-Related Protein FKHL5 Forkhead-Related Activator 1 Forkhead Box Protein F1 FREAC-1 Forkhead, Drosophila, Homolog-Like 5 ACDMPV
Location (GRCh38)
Forensic tag(s)
Sudden unexpected death diagnosis Mechanical injury analysis

MANE select

Transcript ID
NM_001451.3
Sequence length
3520.0 nt
GC content
0.5116

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1200.40 kcal/mol
Thermodynamic ensemble
Free energy: -1263.69 kcal/mol
Frequency: 0.0000
Diversity: 1005.20
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((.((((.((.((.((((((((.(((....))).)).....(((((((((((.((...((.((.(((.((((...)))).))).)).))(.(((((..((.((((((((((.........)))))))))).((((.......)))).......))..))))).).)).)))).))))))).))))))))...))....))))))))...(((..(((......(((((..((((((((((((((.....((((((((((((.(((((.((((..(((((.(.............).)))))....))))))))).))).....(((...)))....))))))))).(((((.((((((((.(((...((.((((.(((((((.((.((((.(((((.((.((.((.(((.(((.((.....)).))).))).)).)).)))))))(((((((.(((.((...)).))).)))))))...)))).))))))))))))).))...))).))))))).).)))))((((((....((....)).....((((((((((((((((((((.((.((((((((((((((((((..((((.....))))..)))).....)))))))).))..)))).)).)))))))...(((((((((.((((((((.((..((((.(((((((....(((((.......)))))...........((((((((.((((.((...(((((.((.(((((...((.....))...))))).)).))))).)))))).))))))))..))))))))))))).)).)).))))...)))))))))..(((((((((((.((..(((((((....((((((...))))))..((((.(((((..(((.....)))..)).))).))))..............)))))))..)).))).)))..)))))............))))))..)))))))...(((((((((.(((((.((((((((.((((.((((..((((((....((((..(((..((.........))..)))..)))).((((((........))))))..((((....))))........)))).)))))))))).)))))............(((((((((((((((((.(((((..((((((((.....))))))))..((((((..((((....)).))..)).))))((((.((((...))))))))((((........))))(((((((((((((...))).)))..)))))))..(((..........))).....(((((....((.((((((...((((((((..(......)..))).)))))...))))))))..))))).................)))))..))))))))..)))))).)))((((((.....((((((((((.(((((((((((((....((((......))))..((((.((((....)))).)))).)).)))))).((((.((((((((((((...((((..(((...))).)))).))))))....)))))).))))..........((((......))))..))))).))))))))))..))))))............((((((((((((((((((...))))))))((((((((.(((((..(((.((.....(.((((((.(((((((((((.((((...((((.(((...(((((........)))))..)))(((((....(((((((.......((((....(((((.(((..((((((.....))))))...)))..))))))))).......(((((((......((((((...((((...((((......((((....))))))))...))))...))))))...........((....))...))))))).......................)))))))....)))))........))))))))...)))).)))))))....(((((((.....((.((........)).))......))))))))))))).))).))).)))))..)))))))).(((....)))(((..(((.(((((.(((((((((((...(((.((((....))))...((((((((..((((((((.(((((.....((((((.((((((......)))))).........))))))....)))))(((((...)))))((((((((...((((((.(((...((((....((((...))))...)))).))).))))))((((((((.((((((.(((((.(((((((..........((((((......))))))........)))))))..(((((......)))))...))))).))))))..))))))))........))))))))......(((((.((((....(((((((.(((.((((((...((((((....))))))..))))))........))).)))))))....)))))))))..................((((((((.((....))))))))))))))..))))..))))))))...(((((.........((.((((((((((((((((((((((...((((.(((((((((((.................)))))).))))).))))..)))))))))))))......)))))))))..))...(((((........)))))......)))))(((((((((...))))))))))))...))))))..))))).).)))).)))..)))(((((........)))))..)))))))))).......((((((..(((((((...(((((...)))))...(((..(((((...((((((((........(((((((..(((((((((((((((....)))))))))))))))....)))))))))))))))..............((.((..(((((.(((.(((((((..(((...)))....))))))))))...)))))..)).))...........((......)).....)))))..)))........)))))))..))))))))).)))))))))))))).(((..((((((((((.......)))))))))))))........))))))....))))))))))))))....((((((((((((..................((((((((...(((.(((...(((..(((((((((((.......................))))(((.((.((((..............(((.(((...))).))).......(((.(((((..(((((((.((((.((((......))))))))))))))))))))...))))))).)).)))....((((...))))..)))))))..)))...))))))..)))))))).......))))).)))))))................))))))))..)))..(((((.......)))))
Thermodynamic Ensemble Prediction
((((((((.(((.(({.{{((((((((((((..((...((((.(,....,(((((((.{.......((.(((.((((...)))).))).))(((((((((((((((((((({((((((.(((((.(((.(....})))...))))).))))...........{(((((...)))))|{({{(,((((((((((............{(((((,.(((((.(((,.....,.,............}.)))))))).|||||(((|(((.(((({{((((..(((((.(.............).)))))....))))))))).))).,...(((...,}}....}}})))})}..))))}}(((((((.(((...((.((({,(((((({,((.((((.(((((.({.((.((.(((.(((.((.....)).))).))).)).)).}))))))(((((((.(((.((...)).))).)))))))...)))).))))))))))))).))...))).))))))).))))..))))))........,{{||,...,..})),,))).))||{(((({({{((((,{((((({((((((,.({((.,{,{||||{{||||{{..{|||||,|,.,,..||||{..{||||,,|,.,,||,.}|||}}}|}},}||||}}}}....((((,..}})),)))}))),.,)})||}|,,,,}}...))))}))}})})),))),)),)}))))}||||{...|{|....||...}}))))))))))))))))))))))))))..,,))))))))),))))..))..))))).)))))))....,((((((((.((((((...)))))).)))).))))|{({((((....,},)})))}...........},.}}.{(((((((((,(((((.{{(((((.(((.,{{,(((((.((((((((((.,((((({....((((.((((......)))).))))...((((.,..((((...((((((.((((.((......((((,...,,,))).({(((.{....,).)}})).((((((((......,,)}))))).((((....))))......)).)))))))))).)))).,)))),,,.,,......,}.})||..........,.,.....,...))))))..}.))))))))))..))))|,,,....)).,..)))..)))))).))))){((((({...((((.(((((.(((((((((((((((((((...))).)))..}))))))),(((.....,},...,,.....(((((....((.((((((...((((((((..(......)..)))},))))...))))))))..)))))...........,.........,...((((((((((....(((((((,(((,((({{{({{{{{{{.{{{{{(((((((,..,,((({.,,,,{|||},.((((.((((....)))).)))),|,,}|||},.,{{|.{||{||({((((,..((((..(((...))).)))).)))))}....}|||||,||||,,,.......((((......}}}}.,}}|||.}}}}}}}}}}.}})}},|||||,,,....,..,,,,,,,,.|||||||,,,||||||,,{,(,(({{,.{.,||||,|{{{{,..||{|,,|}}}},.}}|||||||||||.({({{..(({...{((((........)))))..))}.((((({..{,,(,,({{.,,,,|}},.,}}))}))..,,,,{(((((.....)))))|,{(((,{{{{{{{{,,,|.,,....,{((({{({(((((((((,{{(((({{{(((({({,{{({(({..,|||,||||{{.,,,,...|||||{,{{{,{{,.,{({.,,{({,,...,{{{{.,{{{{,(((({(({,...,}}}}))}..{,.(((((((.............,,,.,,,,}})))).}}},.,{||||{,|,,},.|}}}|,}}},,.,|||||,|}|,|))}|..)))}))}},|))).,)))||||,}||,.({{{{,(,|||},}||{{{(,{,,,{|,.||||,.,||||,|||||||||},.,,|,.....{{{{{{{|,,|||{||||,..|||,|...{{{||||||,||{.,....}|||||,,,,.....}))))}....,,},,(((({...}))))((((((((...,{{{(({((,...,{{{,...||||..|}))||,.,,})}))),}}}}},((((((((.((((((.(((((.{((,((({{...,{...((((((......))))))........))))),}..(((((......)))))...))))).))))))..))))))))........)))))))).,{{{,(((((,(({{.{{,(({(({{,(((.{(((((,,.((((({....}})))),,)}))}},,}}}||,|||,|}}}})),||,))}}}}}}|....,,|,|||,,.....{((((((,{((....))))))))))||||,,|}||..||}}}}))...,,}}|...|||,,,{,,((((((({((((((((((((({...((((.(((((((((((....,{,....,,,...)))))).))))).))))..))))))))))))},,....,}}||||||{,|{,..(((((........))))).....,.}))).})))))}..........,}||||{|{,,,....,)))}},}||,|||,))}}}}}|..{,{{.|||,,}|||||||||........,}}},,||{{{{..{{{{{,,...{((((...))))}...,,,..,,,.{(((((((({{,.....,,{((((((({,(((((((((((((({....))))))))))))))).,..))))))))))))},.,)))}}}},,,,..({.{{..(((((.(({.(((((({..,||.,||},..,,)))))))}))...))))).,)),)}.......,,,,,}}},.||{||.||{|}},},}))).))}}}..))))))},}))))))}},,}))|}}}}}}.{((((((((((((((((((.......)))))))))).........}))))))))..{|||,{.((((((({..(((({,((((.............((((.,,,{{,......,}})).)))),,{.{{{.,...)))}))|,{,.....,,.....)))))}))))))))))).).)))),}}}}.....}}}},,.,||}}.)))})}.........,..{,..}},}}}))),))))))))))....))))))))))))))).))))).))))))))))}((.((.((((((............)))))))).)).....))))}.))))}).....).))).))))))))............................(((((.....)))))........

Transcripts

ID Sequence Length GC content
GCAGAGCAGCGGCGGCAGCGGCGGCGGCGGCAGCAGCCACCCGAUGUCU… 3520 nt 0.5116
Summary

This gene belongs to the forkhead family of transcription factors which is characterized by a distinct forkhead domain. The specific function of this gene has not yet been determined; however, it may play a role in the regulation of pulmonary genes as well as embryonic development. [provided by RefSeq, Jul 2008] CIViC Summary for FOXF1 Gene

Forensic Context

A study in human left ventricle tissues demonstrated that the FOXF1 gene, a prioritized sudden unexplained death susceptibility gene, was significantly up-regulated in unfrozen post-mortem samples compared to thawed samples [Shen et al. DOI:10.1007/s00414-025-03575-2]. A study in humans analyzing pericontusional brain tissue from traumatic brain injury patients via cDNA microarray demonstrated that the FOXF1 mRNA was down-regulated by 56% in a patient with vasculitis (I5), 61% in a TBI patient (T6), and 52% in another TBI patient (T7) [Michael et al. DOI:10.1016/j.jocn.2004.11.003].