Basic Information

Symbol
FOXO1
RNA class
mRNA
Alias
Forkhead Box O1 FOXO1A FKH1 FKHR Forkhead Box Protein O1A Forkhead Box Protein O1 Forkhead, Drosophila, Homolog Of, In Rhabdomyosarcoma Forkhead Homolog In Rhabdomyosarcoma Forkhead In Rhabdomyosarcoma
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_002015.4
Sequence length
5779.0 nt
GC content
0.4662

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1827.90 kcal/mol
Thermodynamic ensemble
Free energy: -1939.91 kcal/mol
Frequency: 0.0000
Diversity: 1527.65
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((....(((((((((.((((......((.(((((((((((.((.((.(((..........))).)).)))))))((((((((((.(((((.((((((((((...((((((..((..((.......((((.(((((..(((.(((((.((.(((.((((...)))).)))))))))))))...)))))(((((.(.....).)))))))))...((((((...((..((((((((...(((((.(((........))))))))...))).)))))..))..))))))........))..))..)))))).)).)))).))))))))).....)))..........)))))))..(((((((((.((((((..((((((.......((....))......))))))))))))..))))))))).......((((((((.((...(((((((.(((...((((.((((((((.(((...((..((((((.((....))...))))))..))...))))))))))).)...)))...))).)))))))...(((((.((((((((((((((...))))).....))))))..))).)))))..))))))))))..)))))).)).(((..((((..((((((((((.......))))).)))))..).)))..)))......)))))))))))))..((((((((((.(((((((((.((((...)))).)))))))))((((.((((.(((((..((..((((((((((.((((((((((..((.......))....)))))))..)))..))))))).)))....))..))))))))).)))))))))))))).(((((((((((((((((((.((......)).))).)))))))......((((((((((...))))))))))...............(((((((....(((((..(((...(((((.......)))))...))).))))).)))))))..))))).))))........))))..((.((((((....(((((((.(((((((..((((((((...........((((......))))....(((((((.......)))))))((((((......))))))(((((....(((......)))((((((..(((((((...((((....))))...((((((((.((((...............(((((.(((((((..((...((.((((.......((((((.((((..........))))))))))(((.....)))((((.........))))..))))..))..))..)))))))...))))).((((((((((.....)))))).))))(((....)))((((((......)))))).....(((((((.((...)).)))))))....(((((((((((((.((((((((((((..(((((((....)))))))))(((((((.......))))))).....................((((((.....((((.(((.............))).)))).)))))).)))))).......)))).))))))..))).))))..((((.......))))..))))))))))))....((...))..)))))))..))))))...)))))..))))))))..)))))))..................(((((((((..((.(((((((((....(((((((((((((........(((((((((((((..((((.((((((((((...(((((((.......((..((...((((((....))))))))..))..))))))).))))).....)))))....))))....)))).))))))))).(((((((((.......)))..))))))......(.((((((.((.......)).)))))).)....(((((.(((..((..((((((......)))).))..))..))).))))).(((...)))..((.((((((.((((((..((((((..(((((.....))))).....((.((((..(((((((........)))))))....((((....((.(((....))).))....)).)).((((((.....((((((((.....((((.((((((......)))))).).))).)))).))))....)))))).((((.(((((((....)))))))..))))(((((..(((((..(((((.(((....(.....)...))))))))..)))))))))).((.....))...(((.(((.(((((((((..............)))))))))..))).)))..)))).)).....(((((........))))).))))))))))))..)))))).))..(((((((((((..(((....)))..........(((((((...(((((.(((((((....(((....))).))))))).........((((.(((((.((........)).))))).))))................)))))...)))))))...((((((...((((....((((((((.(.((......)).).))))))))..))))..))))))...(((((.((((..((.((((.(((((((....)))))))........................(((((((..((..(((((.((...(((..((.(((.((((((((...((((((((.((((((((...)))))))).))...((((.............))))..((((((.....((((((((.......))))).)))....))))))(((.....)))..((((((((....))))).)))..))))))..))))))))))).))..)))...)).)))))..))..)))))))..)))).)).))))))))))))))))))))(((.((((((((((.(((.(((((((((((((..((....))..)))))........((((((((((((...((((..................)))).)))).))))))))............(((((....(((((.....))))).....)))))........)))))))...(((((((..((((.(((((((.(((........)))))))))))))))))))))......((((..((((((((.((...(((.......)))...)).))))))))...))))).))).)))))))))))))...)))))))))))))(((((((...((((((.(((((..........((((..((.(((......(((.((((((.((((...(((((...(((((((((((((((((((..................))))))).....))))...)))).))))((.((((..((((.....))))..)))))).((((...((((((((.((..(((((((..(((((((((((.((.((((..((((((...........))))))....((((.(((....(((((.((((((.....))))))......(((((.....)))))(((..((.((((.(((((((.((((((((((((((((((((.((((.(((.(((((...(((.((((((((((((((...))))))))))........(((((((...(((((.((((....((((((((((.........)))).)))))))))).)))))....))))))))))).)))))))).))).))))((((((.((((........)))).)))..))).........(((((...)))))...((((..(((((((((.((((..((((.((.((..((((((((....(((((((((...(((((((.....((((((((....))))))))...((((.(((...((.((((((.((..((((.....(((((((.((((((.(((...(((((...))))).((((.......)))).....((...((((.(((((.........))))).))))....)).....((((.(((((.......))))))))).....(((((((...((.((..(((((..(((.((((.....(((.....)))..)))).)))..))))).....)).))....))))))).......((((....))))((.((((((.(((...)))))))))))((((((((((((((((((((...))))))))(((..((((..(((..(((.......)))..)))..))))..))).....((((.....((.....))..)))).....))))))))))))..)))..)))))).)))))))...))))..)).)))))).)).))).))))((((((((((((......)))....)))))..))))..))))))).....))).))))))(((....)))..((((..((((((..((((((.((((((((......(((.(.((....)).).)))....))))))))......(((((....)))))..))))))..)))).))..))))..)))))))).((((.......)))).(((((((..(((..(((((.(((....((((.....))))..)))....((((.........))))..........((((((....)))))).....(((((........))))).))))))))..)).))))).)).))...))))..)))).))))))))))))).((((.....(((((((.(..((.(((....))).))..))))))))..)))))))))))).........)))))))))))).))))))).)((((.(((((.....))))).)))).......))).))..)))......)))))....))).))))..((((((((((((((((...(((((.((....(((((((....................)).))))).)).)))))...)))))))...))))))))))))).)).)))))))))))...)))))))..)).))))))))....))))..(((((...(((((((((((....)))))))))))..)))))((((......(((.....)))......))))...))))).)))))))))))))......))).))))))))))).))))))..))))))).....((((........))))((((((((....(((((....)))))..(((((...(((.......)))...)))))(((((.((((((((..........(((((....))))).......................(((((((...))))))))))))))).)))))......................)))))))))))))))))...(((......)))........(((.(((((.....))))).)))....((((((......)))))))))))))))))..((((.....))))(((((.((((.....))))...))))))))))))((((.((((...(((((((..((((((((........((((..((((((.(.......).)))))).)))).))))))))....(((((.((((((((((.(((((((...((.(((((...))))).)).))))))).)))...........))))))))))))...............))))))).))))...))))......(((((...))))).)))))).)).
Thermodynamic Ensemble Prediction
......({{(({,,((((((.(((((((.((....)).)))))))..)))))){{{,,{{{{{((({((.(((,((((((((.(..(((((((.((({.,({(({{{((((((...{..........)).))))||||},||..(((((,(({((({{((({..|}||,|||||||||||||...})))}|}}|||||||,,(({{{|||||,..((((....))))..(((((,(({|,{({({{{{,...,,,,}))}}})))}.})))))))))))))).,}},)))))))..}))))))))))),}}.||{||||,|,|||,,,....,,,|({{{{{{{,{,{{|((({{,,((((((((.((((((,.((((((.......({....))......)))))))))))).,))))))))},..,,.,||((({(|||{,..{|||{||.|((,,,{{{,,|((({{{(,(((,,,{(.,((((((.((,,..}}...|||||}..||,..|||}||||}},.|{,,||}...))},))}}})),,.|||{|}|||(((((((((((...))))),...,})))))..|||{|||||,,||,|||}||,.{{{({(({|,.{((..((((,.((((((((((.......)}))),)})}),.).}}}..}})..}|{||,|||{{{((((,..{{((((((((,(((((((((.((((...)))).)))))))))((((,((((.(((((..((.,((((((((((.((((((((((.,((.....}.)}....))))))).,)))..))))))).)))..,.))..))))))))).))))))))))))))})))}})}}.||||||||||}|{}}..}.)).)}}.)})))))}}}...((((((((({...}))))))))),{,.,,.........)),,,,}).)})}})))))}.}.}))})},,..)}})))||{..{{{.,|||{|,,|||,|((((((((((((.((((((((((..{((,({,,(((....))).|,,(((((((..((((((((....,.....,((((.....,||}}....,{{{{{{,,,..,,))))))|((((((......)))))){(((((.(,(,,.,,...,,|((((((,.({((({{...((((....))))...((((((({,((((....,...,||....(((((.(((((((..((...((.((((.......(((({(,((((.{......,.))))))))))(((,....))){(((.........)))}..))))..))..))..)))))))...))))).,{{{|||{({...,,|||}||.},,,(((....)))((((((......)))))).....(((((((.({...}).)))))))....(((((((((((((.((((((((((((..(((((({....}))))))}}(((((((.......))))))).....,,......||,....,||{|{{.....{{{({{{{,...,,,....,.}))}))}}.}}))},.))))))}......}))).))))))..)))))))).,||||,......}}))..))))))))))))...,||,.,))},))))))),,)))))),..},},,,.))))))))..)))))))......,,.............|{{{,.{{{{{((((((((,...{(((((((((((((........{((((((((((((..((({.((((((({((...(((((((.......((..((...((((((....))))))))..))..))))))).}}}))}}}}}))})).,,.}|}}....}))).))))))))}.(((((((((.......)))|,,}|}}},.....{.{{{(((.(|,,.....)),))}}}),}....(((((.(((..((..((((((......)))).))..))..))).))))).{{,...})),.{{.((((((.((((((,,{{{{{{..(((({.....})))).....((.{(((..(((((((........)))))))....(({{,...({.(({....|||.}}....,),)}.((((((.....((((((((.,...(((,,{((((({....})))))).).))).))))},)))....)))))).{(((.(((((((....))))))).,)||}{((((..(((((..(((({{(({..{{{.....}.}}))))))))..)))))))))}.||...,.,,...(((.(((.(((((((((..............)))))))))..))).)))..)))),)}.....(((((........))))).})))))))))))..)))))),))..(((((((((((..,,,....,}}..........(((((((.,.(((((.(((((({.{,,,{{....}}},}))))}}.........||||.||{{{.||,.,.....,,.,}}}}.,,,,,,,,........}}}}))))).,.))))))).,{((((({...{(((....((((((((.(.((......)).).))))))))..))))}})))))}...(((((.((((..((.((((.{{(((((....)))))||,.......................(((((((..((..(((((.((...(((..((.((,{((((((((...(((((({({((((({((...,}}}))}),}},,,((((.....,,,}}.,.})},..((((((.....(((,{,(({......,)))}.)))....))))))(((.....)))..((((((((....))))).)))..))))))..))))))))))).))..)))...)).)))))..))..)))))))..)))).)).))))))))))))))))))))(((.((((((((((.(((.{((((((((((((..((....))..))))).,,,..,.(((((((({{((...((((............,.....)))).}))}.)))))))).....,,,,...{((((..,.(((((.....)))))..,,.)))))........)))))))...(((((({.,((((.(((((((.(((........)))))))))))))))))))))......{(((.,((((((((.((.,{((,......})))...)).)))))))}..,))),}.))).)))))))))))))...)))))))))))))}{{{{{{.,.{(((((,((((({{{,,,..,,(({{.,((,{{{,,....{((.{((({,,{{||,.,|||{{.,,((((((({{{,{((({{({,,....{|,,,,},.,},},}}}}}.,},})))},,,|}||.,||,{(.((((..((((.....))))..))))}}}|{{(,{,((((((((.((..(((((((..(((((((((((.({.{(((,{{,,,{||||||||||,,,,,,||,...{{{{.{{{,,,.{{(({.((((((,...,))))))..,,..{{{{{..,,,|}|||{{{..{{,|||,,(((((((.((((((((((((.,.,((((..(((((((.,(((......,|||,.{(((((((((...)))))))))}.{{{....,,|||,,....{(({.,((((,,.{{{{{|||||,...,,,..}}},.}))))).,.),}}))}...{|||||||..{(({.{{({{{{{{{.,...,,}|}}}||||.,}}.,}.)),,})))}}))...))))))))}||{{,.{((((((((((...(((((((((.((((..((({.,({((..((((((({....,{(((((((...(((((((.,,,.((((((((....))))))))...((((.(((...((.((((((.((..((({....{((((((((((((((.(({.,,(((((...})))),{(({,{,,,{,||||,....((...((((.(((((.........))))).))))....)).....,|,|,|||||.....,{||||||,||,....(((((((...((.((..(((((..(((.((((.....(((.....)))..)))).)))..))))).....)).)).,..)))))))....,,,,|}},..})))}{{,((((({{(((...)))))))))|}((((((((((((((((((({...})))))))(((..{(((..(((..(({.......}))..)))..})}}..}))}....,,.,}}},.||,....}}..,,,,.....)))))))))))).,)))..))))))))))))).}}}))))..)).)))))).)).))).))))||{(((((({(.{{{....))}}},)))))..))))..))))))).....))).))))}|(((....))),.((((..((((((..((((({,((((((((......(((.{,((,...))}).)))....)))))))).,....(((((....)))))..})))))..)))).))..))))..}))))))).,{{|,,,,...}}},.........,{{,.,{{,,({((......,,|}}}....,,|||||....{{{{.........)))}........,.((((((....)))))),,{{,((((,........})}}),)))))..,((({{....}}))}.}}}}))))..)))).))))))))).....,{{{.....(((((((..,{((.(((....))).)).})))))))).,)}}))))))))))}..}}...)))))))))))).))))))){|{({{,{{{{,.....})))}.))}},},..},)))|}},,))},,,,..}}}}}...,)))|})}},.(({({(({{{((((((...(((({.{{....{((((((..,...{{.....,,,,.,.))}}}))).}}.)))))...)))))))...)))))))))}}}}.}).)))))))))))...}))))))..)).)))))))).,,.}}}}..{((({.,.(((((((((((....)))))))))))..))))}(((({{.,..,,|,.}}})))......)})},,,})))).))))})))})))).,,,,.}}}.,,}}})))}},.}})))),,)))))),....,{{||.,......}|||,,{,,......,}))}}...)))))..}}||||}}.,,|},,.....,....}}}}}(((((.((((((({..........{((((....)))))...,,..............,,..(((((((...)))))))}))))))).))))).,,,,,,,,,..,,......}})),}}}}||||||,}}}....}|,|||,,,{|,,....}}))))}))).))))))))))))))))..((((((......)))))){(,(({,(((...((((.....)))).,,..)))))).}|{(((({..{{({.....,..}})}...})))))},,,....|||||||,.}}}.}}}||,,}}|,,|||....}}}}})}))))))})|||{||||||||..,.|{{({.{{{{{{|||,.(((((((.,,((,({{{{...))))),}}.))))))).))),,,.....,,,||||,},||}||...,|}|||,.,|||))}},,,.,,},},,|||...,|,.{{{{|,..,}})},}}}},,}}..

Transcripts

ID Sequence Length GC content
GAUCCCGUAAGUCGGGCGGCCUGGUAGUCGCAGCAGCCGCUGCCGCAGC… 5779 nt 0.4662
Summary

This gene belongs to the forkhead family of transcription factors which are characterized by a distinct forkhead domain. The specific function of this gene has not yet been determined; however, it may play a role in myogenic growth and differentiation. Translocation of this gene with PAX3 has been associated with alveolar rhabdomyosarcoma. [provided by RefSeq, Jul 2008] CIViC Summary for FOXO1 Gene

Forensic Context

A study in mice demonstrated that the transcription factor FOXO1 was predicted as an upstream regulator with a negative activation score in the prefrontal cortex under conditions of both E2F3b overexpression and cocaine self-administration [Cates et al. DOI:10.1038/s41386-018-0296-1]. In pigs, research showed that FOXO1 was upregulated in Enshi black pigs in response to cold exposure but downregulated or remained unchanged in Min pigs, identifying it as a potential regulator in the cold response [Guo et al. DOI:10.1016/j.jgg.2024.06.017].