Basic Information

Symbol
FSCN1
RNA class
mRNA
Alias
Fascin Actin-Bundling Protein 1 P55 SNL 55 KDa Actin-Bundling Protein FLJ38511 Fascin FAN1 HSN Fascin Homolog 1, Actin-Bundling Protein (Strongylocentrotus Purpuratus) Singed (Drosophila)-Like (Sea Urchin Fascin Homolog Like) Epididymis Secretory Sperm Binding Protein Fascin Homolog 1, Actin-Bundling Protein Singed-Like (Fascin Homolog, Sea Urchin) Singed, Drosophila, Homolog-Like Actin Bundling Protein Singed-Like Protein
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_003088.4
Sequence length
2784.0 nt
GC content
0.6501

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1252.30 kcal/mol
Thermodynamic ensemble
Free energy: -1297.29 kcal/mol
Frequency: 0.0000
Diversity: 667.14
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((.(.(((((((((((((((((((((..((((((((.(......((((..((((((.((((.((((....((((.(((((((...((((((((...)))))))).........((((((.((((((((..((((...)))).))))))(((((......((((((...(((..(((........)))..))).))))))((((..((.(((((...))))).))..))))....((.(((((((((((....((((.((((((.(((.((..((((..(((((((((.(((((((.....))).)))).)))((((((((((((.(.((((((.((((..((((.(((..((((((.((((.((((.((((((((((...((........))...)))).))))).)..)).)).)))).))))))))).))))..(((((....))))).((((((.....))))))((((.((((.(......).)))).)))))))).)))))).).)))))...(((((........))))).))))))).....(((((.(((((...(((..(((((.(((((......))))).)))..))..))).)).))).)))))..((((((((((....)))).))..))))..........)))))).))))....))))).)))))).))))(((((.......(((..(((.(((.((((((.((((.(((((((.((((((((((((.....((((((..((((((((...))))))))...))))))..))).).)).)).))))))))))).)))))))))).))).))).)))........)))))....(.((((....)))).)..((.((((((((..(((....))))))))).)).))..((((((((((.((.((((..((.(((..((.(((((((.(((((((((.(((.(((((((........)))).)))...)))))).(((.....))).(((((((.......((.((((......))))))...((((......))))((....((((.(((((..(((...)))..))))).)))).....))))))))).....((((....(((((((.......)))))))((....((((((((........((((((((..((...(((((((((((..........(((((((((((((((....)))).((.(((.((((.....((((((........).)))))........)))).....((((((((....))))))))))))).))))))))).))))))))))))).)).))))))))....(((((((((..((.....)).))))))))).....))).)))))....))...............))))....)))).)))))))))))..))))).)))).)).))))).)))))..(((...)))))))))))))).)))))))........)).)))))).....)))))))..))))...))))..(((((((..((.((((.........))))))((((...))))((((...(((..(((((((.....))))))).)))..))))...(((((((..((((((.((((((............(.....)............)))))).))))))....)))))))(((((((....)))))))(((...((((.....)))).)))...((((....)))).)))))))...(((.....)))........((((((((((...((((.......(.(((((.((((.(.((((((((((.(((((((((.....((((((((((((....(((((((((((((..(((...(((((.....((.(((((((((((....)))))).....((((.((((..(.((((..((((.((..((((((((((((....((((((.((((...)))).)......)))))))))))))).)))))))))))))).))))))))(((((((....).))).)))..))))).))........))))))))..))))...(((((((((((((((((((.(((...((.((((((....(((.((..(((((.........(((.((.(((((....))))))).)))))))).))))).)))))).)).))))))))))))..))))(((((((((((.((((....(((....)))))))))))))))))).))).))).)))))))))))))))))))))((((((.(((......((((....((((..(((........)))..)))))))).....))).....(((((...((((....))))......)))))((((((((((..((.(((((.((((...)))).)).)..)).))..)))))))))).((((((((....))))))))......)))))).......)))))))))(((((((((..(((...)))..))))))..)))....))))))).))).).))))))))).).......))))...))))))))))........)))).))))))))))(((.(((((((((....)).))))))).)))).)))))).))....)))).......)))))))))...(((((((((.((((..((.(((....((.......))...))).))..))))))))))).)).....(((((......))...))).................))))))))))))
Thermodynamic Ensemble Prediction
.{((.(.((((((((((({((({({(((..((((((((.{......((((..((((((.((((.((((....((((.(((((((...((((((((...)))))))).........((((((.{(((((((..((((...)))).)))))){|{,.......((((((,,,{{{,,({{.......,))}..))).))))))((((..((.(((({...})))).))..)))).{{{(,,(((((((((((,.{,(((,.,,((((({((.(((((((....))).)))).||(((((({,({({|,||||.|||}|,,.}|||||,.{{{||||||{{{{.|{(((((((.((.((((.{,{.{(((..,))))}})))).))..)))))},}}},..((((((,.((((.(({{,(((((((((((({(({.,,{({.({(({{..((,((((((((((((....(.((({,(((.(({{(((.....))))))))))))))))))))}},))))}.|}||||,,.}}}...))))|.|||{(({.......,...(((.....}}}..||||,..)))},})}))),)}))))))))},)))..}.))).)))),.)))))){((({(((((,((({.({{.{{{{{.,{....{||||{.,||}|{{,.{{{|....}}))}),},{{(({,,.,..,|{{..{||.(((.(((({{{((((.(((((((.((((((((((((.....((((((..((((((((...))))))))...))))))..}}),).)).)).))))))))))).)))))))))).))).))),))}.,|,,...))))),,..{.((((....)))),)..((.{((((((|.|(((....})))))))).)),)}.)|||{||{{|{}||}||,,..,|,|||..,|},|||,||}|,|||||||}}|,.{{|||||,,,..,}})),},|||...||,,,}.||,,.},}}))}||{{{||,}|(,{{(({((((......))))||..,{(((......})))),..|.{{((.(((((..(((...)))..))))).))||{{{{{{.,{((((......((((...,(((((((,{....,)))))))|,,...((((((((....,{,.((((((((..((...(((((((((((..........(((((((((({((((....)))).,,.,{,.((((.....((((((........)}}))))........)))).....((((((((....)))))))))},...,)))))))).))))))))))))).)).))))))))....(((((((((..{{.....},.))))))))),....)))},)))).....,...............))))....))))})))))))),}}..}},))})))).}|.}}||}||}},,.}}})})))}.))))))))))}.).,))))........}}.)))))).....)))))))..))))...))))..(((((((..{{.((((.|.....}.))))}}((((...}}}}((((...(((..(((((((.....))))))).)))..))))...(((((((..((((((.((((((.....,......,.....}............)))))).))))))....)))))))(((((((....))))))){((...((((.....)))).))}...((((....)))).))))))).,.{((.....)}}........((((((((((..,(({,.....,.(.(((((,((((.(.((((((((((.(((((((((...,,((((((((((((....(((((((((((((..(((...(((((.....{{.(((((((((({....})))))......,(({((((..(.((((..((((.((..(({(((((((((....(((((,.{(({...}}}}.,......)))))))))))))).)),))))))))))}.))))))))(((((((....).))),,))..))))).))........))))))))..))))...(((((((((((((((((({,((({,,(({((((((....(((.((,.{((((.........(((.((.(((((....))))))).)))))))).))))).}))))},))}))))))))))))..))))(((((((((((.((((....(((....)))))))))))))))))).))).))).)))))))))))))))))))))((((((.({{....,.{(((,..,((((..(((........)))..)))))))),....))).....(((((,,,{,,,....)))),,,,..))}))((((((((((..((.,{(((.((({...)))).)).)..}}.))..)))))))))).((((((((....))))))))......)))))).,,....)))))))))(((((((((..(((...))).,))))))..)))....))))))).))).}.))))))))).).}.....})))...)))))))))).}..,...)))).))))))))))(((.(((((((((....)).))))))),))}}.)))))).))..,,))))}.,,,..,}}}}}}}}...,{(((((((.((((..{{.(((....((.......))...))).}}..))))))))))).)}..,..||{||...,||},...,},..............,..)))))))))))}

Transcripts

ID Sequence Length GC content
GUGGAGCGCUGCGGAGGGUGCGUGCGGGCCGCGGCAGCCGAACAAAGGA… 2784 nt 0.6501
Summary

This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15. [provided by RefSeq, Sep 2011]

Forensic Context

A study in the forensically important fly *Sarcophaga peregrina* demonstrated that the FSCN1 is a consistently up-regulated gene marker during postembryonic development from larval to pupal stages [Ren et al. DOI:10.3390/insects13050453].