| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCCAGACGUUCUUCGCCGAGAGUCGUCGGGGUUUCCUGCUUCAACAGUG… | 1203 nt | 0.4996 |
This gene encodes the heavy subunit of ferritin, the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in ferritin proteins are associated with several neurodegenerative diseases. This gene has multiple pseudogenes. Several alternatively spliced transcript variants have been observed, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the FTH1 is a top cluster-defining gene for a 'Ferritin Expressing' macrophage subpopulation in the meninges and is upregulated in meningeal macrophages one week post-traumatic brain injury in young animals [Bolte et al. DOI:10.7554/eLife.81154]. In a porcine model of cutaneous bromine injury, the FTH1 was identified as a significantly increased transcript in the 8 min–24 h exposure group and is involved in the NRF2-mediated oxidative stress signaling pathway [Price et al. DOI:10.1016/j.toxlet.2008.08.007].