Basic Information

Symbol
FTH1
RNA class
mRNA
Alias
Ferritin Heavy Chain 1 FTH PIG15 FTHL6 PLIF FHC Cell Proliferation-Inducing Gene 15 Protein Proliferation-Inducing Protein 15 Placenta Immunoregulatory Factor Ferritin, Heavy Polypeptide 1 Ferritin Heavy Chain Ferritin H Subunit Apoferritin EC 1.16.3.1 H-Ferritin NBIA9 HFE5
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_002032.3
Sequence length
1203.0 nt
GC content
0.4996

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-356.00 kcal/mol
Thermodynamic ensemble
Free energy: -381.20 kcal/mol
Frequency: 0.0000
Diversity: 240.20
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((.((((...........(((.(((((((..((((.(.(((((......))))))))))))))))))))............(((.(((........))).)))...)))).........(((((((.....(((((((...(((....)))(((((((((..((.((((.((....)).).))).(((..(((((((.(((((.(((...........((.((((((((..(((.(..(((......((.(((..((((((((((((.((((..((((((...(((..(((((.....).))))...)))...))).....(((..........))).))).)))))))))))(((((((..............)))))))((..((((.....)))).))......)))))...))).))...)))..).)))..)))))))).)).....(((....))).................))).))))))))))))..))).....))..))))))).)).((((((((......))))))))..((((....))))((((((.((((..((((.(((.(((.(((((.....))))).)))(((((((..((((((...((((((........(((....)))(((((((((((((((((........(((((.((((((....(((((.((((((....((((((((....((((.((((..(.((......)).)..)).)).))))......))))))))))))))....)))))....(((....(((((((.....)))))))..)))..)))..))).)))))........))))))......((((((((......)))...))))))))))))))))..((((((....(((.......)))...)))))).)))))).)))))))))))))...((((((........)).))))(((..((((...)))).)))..))))))))))).)))))).......((((((...........((((...............))))))))))..))))))).......))))))).((((((..(((((...((((((..((....))(((((((....))))))).((((((.((....((...))....)).))))))....))))))..)))))..)))))).....)))....
Thermodynamic Ensemble Prediction
((({((({,,,...,..|,(((.(((((((,.{(((.{.(((((......))))),)))))))))))))),...........(((.(((........))).)))....,...........(((((((...,,(((((((...(((....)))(((((((((,,({.(,{(.((....}}.}},)}.|{({,(((((({,(((((.(((...,..,...,|(.((((((((..(((.{,.(((..,,..((.(((..((((((((((({,((((..((((((...(((..(((((.....),})))...)))...))).....(((..........))).))).)))))))))))(((((((..,...........)))))))((..((((.....)))).))......)))))...))).)).,,))),.}.)))..)))))))),))..{{,({{....)))......,..........))).))))))))))))}}))),,...))..))))))).)).((((((((......))))))))..{(({....})}|((((((.((((.,,(({,(((.(((.(((((.....))))).)))(((((((..((((((,..((((((......,.|||....})}((((((((((((((((.,,..,,..((({(.(((((,..,{(((({.((((((....((((((((....((((.((((..(.{(......}).)..)).)).)))).,....))))))))))))))....}}}))}}}.(((....(((((((.....)))))))..))).,)))..))).)))))(((.......})}........,,|,{{,......})}..)))))})))))))))))..((((((....(({.......)))...)))))).)))))).)))))))))))))...((((({........)},))))(((..((((...)))).)))..))))))))))).)))))),......,{{,,{......,..,.((({..,,|,.......,,}}}},,,}))}})))))))...,...))))))),{{((({{,{{{{|||,||{{{{..||}}},..(((((((....))))))).|||,,..,|,...,,...))|{{{||{|,||{{,...||||{,..}))}}..})))),....})))}},.

Transcripts

ID Sequence Length GC content
GCCAGACGUUCUUCGCCGAGAGUCGUCGGGGUUUCCUGCUUCAACAGUG… 1203 nt 0.4996
Summary

This gene encodes the heavy subunit of ferritin, the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in ferritin proteins are associated with several neurodegenerative diseases. This gene has multiple pseudogenes. Several alternatively spliced transcript variants have been observed, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the FTH1 is a top cluster-defining gene for a 'Ferritin Expressing' macrophage subpopulation in the meninges and is upregulated in meningeal macrophages one week post-traumatic brain injury in young animals [Bolte et al. DOI:10.7554/eLife.81154]. In a porcine model of cutaneous bromine injury, the FTH1 was identified as a significantly increased transcript in the 8 min–24 h exposure group and is involved in the NRF2-mediated oxidative stress signaling pathway [Price et al. DOI:10.1016/j.toxlet.2008.08.007].