Basic Information

Symbol
FTL
RNA class
mRNA
Alias
Ferritin Light Chain Ferritin L Subunit NBIA3 FTL1 Ferritin Light Polypeptide-Like 3 Ferritin, Light Polypeptide Ferritin L-Chain MGC71996 Neurodegeneration With Brain Iron Accumulation 3 Epididymis Secretory Sperm Binding Protein L Apoferritin LFTD
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_000146.4
Sequence length
871.0 nt
GC content
0.5603

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-319.90 kcal/mol
Thermodynamic ensemble
Free energy: -334.03 kcal/mol
Frequency: 0.0000
Diversity: 182.50
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((....(((((((((.(((((((((.(((...(((((......))))).)))))))))))))))))).....((((((((((.((((((..((...(((((..(((((....((....)).....(((((((((((...((.......))((((((((......((((.(((((((.((........)).)))))..)).)))).....(((((....)))))..(((((....))))))))))..)))...(((((((.......(((..((.(((...))).))..)))......)))))))...........(((((.((.(((((((((.....)).))))))).)).).))))...)))))))))))))))).)))))...)).((((((.....))))))......(((((((...)))))))...((((((((.....((((.(((((((((((((..((((((...))))))..)((((((........))))))(((((.............))))).((....))))))))).))..))).)))).....((((((........))))))...))))))))..(((((((((.....))))))))).(((((((.....))))))).....((((...........))))..))))))..))))))))))((((((((((...))).(((.(((((((....((......))....))))))).))))))))))..........((((((.((((...))))..))))))(((((((.((...........))...))))))).(((((......(((...........)))......)))))....)))......))).
Thermodynamic Ensemble Prediction
(((..,,((,((((((.(((((((((.(((.{.(((((......)))))})))))))))))))))))).....((((((((((.((((((.,{{....,{{{,{((({,....{{..,,))....{(((((((((((..,,{{{,.{((((({..,{|,,,....(({,.,{(((((.((........)).)))))..,},)}))}}}}}||{{{....))},,..(((((....)))))|||,|..|||...,((((((,......(({.,{{,(((,..}}}.},.,}}}......}})))}}......,,|..(((((.((.((((((({{.....)}.))))))).)).),)))),..))))))))))))}))).)))))...,}.((((((.....))))))......(((((((...))))))).,{{(((((((.....((((.(((((((((((((..((((((...))))))..)((((((........))))))(((((,,......,}...))))).((....))))))))).)}..))).))))....,((((((........))))))...)))))))),.(((((((((.....))))))))).{((((((.....)))))))..|||((({.,.........}}))..))))))..))))))))))((((((((((...))).(((.(((((((....((......))....))))))).))))))))))..,,...,,{((((((.{({{...))}}..))))}}(((((((.({...........)}...))))))).{{{{{......{{{......,..,,))}.,....))},...,.)))....}.))).

Transcripts

ID Sequence Length GC content
GCAGUUCGGCGGUCCCGCGGGUCUGUCUCUUGCUUCAACAGUGUUUGGA… 871 nt 0.5603
Summary

This gene encodes the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in this light chain ferritin gene are associated with several neurodegenerative diseases and hyperferritinemia-cataract syndrome. This gene has multiple pseudogenes. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that hyperoxia exposure induced diffuse alveolar damage, leading to a significant upregulation of the FTL mRNA, which suggests hyperfunction of the reticulo-endothelial system due to hemorrhaging [Shimada et al. DOI:10.1007/S00414-008-0226-6].