| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGUUCGGCGGUCCCGCGGGUCUGUCUCUUGCUUCAACAGUGUUUGGA… | 871 nt | 0.5603 |
This gene encodes the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in this light chain ferritin gene are associated with several neurodegenerative diseases and hyperferritinemia-cataract syndrome. This gene has multiple pseudogenes. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that hyperoxia exposure induced diffuse alveolar damage, leading to a significant upregulation of the FTL mRNA, which suggests hyperfunction of the reticulo-endothelial system due to hemorrhaging [Shimada et al. DOI:10.1007/S00414-008-0226-6].