Basic Information

Symbol
FTSJ3
RNA class
mRNA
Alias
FtsJ RNA 2''-O-Methyltransferase 3 FtsJ RNA 2'-O-Methyltransferase 3 SPB1 Pre-RRNA 2'-O-Ribose RNA Methyltransferase FTSJ3 FtsJ RNA Methyltransferase Homolog 3 Putative RRNA Methyltransferase 3 Protein FtsJ Homolog 3 SPB1 RNA Methyltransferase Homolog (S. Cerevisiae) 2'-O-Ribose RNA Methyltransferase SPB1 Homolog RRNA (Uridine-2'-O-)-Methyltransferase 3 SPB1 RNA Methyltransferase Homolog Pre-RRNA Processing Protein FTSJ3 FtsJ Homolog 3 (E. Coli) FtsJ Homolog 3 EC 2.1.1.- EPCS3
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_017647.4
Sequence length
3551.0 nt
GC content
0.5390

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1288.50 kcal/mol
Thermodynamic ensemble
Free energy: -1345.15 kcal/mol
Frequency: 0.0000
Diversity: 708.22
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((((.(((..((.(((((......))))...).)).))).)))))..(((...(((((((((((..((((.(((((.((.((......((((((.(((((((.((((....(((((.((((..((....)).))))......((((.((((((..(((.(..((((((((.(.((((....(((((.(((((...))).)).))))).((((....)))).)))).)))))).)))..).))).))))))))))..........)))))....)))).))))))).))))))......)).))))).....)))))).)))))))......))))...))).....(((.((((.((((((.(((((...)))))))))))((((((((((((((..((((((......((((..(.((((((((..(((((((((((((((...(((.........)))...)))))..))))).....)))))((((.........))))......((((((.....((((.(((((..(((..((....))............((.((((((((........)))))))).))...))).))))).))))...))))))....(((((((((.(((((((((((.((((((.....((((((....))))))....(((((......)))))..((((((((((((........)))).))).)))))((((.(((((((((...(((..((((((.((....)).)))))).)))..((((((((((((.((.((...)))).)))..(((.(((((((((((....)))...)))))))).)))(((.(((((.(((((.((.(.((((....)))).))).)))))))))).))).....)))))))))....(((((((.(((.((.(((((.((((((.....))).)))...).)))).)).)))..)))))))(((((((.((((...)))).)))))))...)))))))))......))))..(((((((((.....((..(....)..)).......))))))))))))))).)))))))))))((((((((.(((...((....))((((((((..((......((((((((((.......((((((((((((((((((.(((.((((.....((.....)).....((((.(((((((((((...........)))))...)))))).))))..(((.(((((((..((((...((((((..((((......(((((....)))))....((((((.............))))))(((((.((....)).)))))..((((((.((.((((..(((((((....)))))))......)))))))))))).....((((((((..(((((((((...)))).(((((((((((..((((((...(((((.....))))).....))))))...((.((((((.((..(((((..(..((((.....))))..)..).)))).)))))))))).....(((((..((((((.......((((((.......))))))......))))))..((.(((((..(..((.((....))..))..).))))).))))))))))))))))))....((.((.((((.....)))).)).))...........)))))((((....)))).)))))))).)).))..))))))..)))).....))))))).))).......))))..))).))))))))))..................))))))))))).)))))))..))..)))))))))))))))))))........(((((.(((.....)))..))))).)))))))))...))))))))...)..))))......))))))...)))).....))))...))))))..((((((((((((((((((((((......))))..((((......)))).......((((((((..(((((....)))))....))))))))((((((((..........)))))))).....(((((...(((((((((.(((((((((...))))).....(((.(((.((((....)))))))..))).......(.((((((((((.(....(((.(((((((((((((.((((....((((((.((((((((.............)))))))).)).....((((((((((((((.((((....)))).))((((.(((...........(((((((((((((.......((((....(((((((((..((((((.((.((....)).)).)))))).........))))))).(((....))).(((((...)))))..((((.((..((.((((((.((........)).)))))).))..)))))).((((((((((((((((.....((((((...(..((......))..).((((((((((((((((.(((((((.........((((((....(((((((........))).....(((((((((..((((((........))))))..))).)))))).)))).))))))....(.((((..........)))).).)))))))))).))))))))))))).))))))...))))))..(((....)))........((((((((.((................)).))))))))..(((((....((((((((.....((......(((((((........(((((((((.(((((.....(((.(((.(..(((.(((..........)))..)))...).))).))).)))))..))))))))).(((....))).............)).)))))......))...)))))))))))))..(((....)))(((.....)))........((((.....))))...))))))..))))))....))))........)))))))))))))..........))).)))).((((((((((.(((......)))((.(((.(((...)))))).))..(((...(((.....((((((...(((.....)))...)))))).....))).....)))...))))))).)))...................((....)).))))))))))))..((((......))))..((((.(((((.(((((((...(((..(((...)))..)))))))).....))..))))))))).((((.((((...(((((.......)))))..))))))))))))....)))).))))))..))..)))))...)))...).))))))).))).)))))..))).))).))).....)))))......))))).)))))))).((((((............))))))..(((((((((.(((..(((((.....)).)))..)))))))).))))....((((.......)))))))))..)))).)))...(((((........)))))....))).
Thermodynamic Ensemble Prediction
..(((((((.((..((..(.((..((((((((((.((({(((.(((((..(((..((((.(((((((..(((({(((((((((.,(((,......((((((.(((((((.((((.(({...})).))))((((..{{.(((((...,.{((((.((((((..(((.(..((((((((,(.((((..{.(((((.(((((...))).)).))))).((((....)))).)))).)))))),}))..).))).)))))))))).}........)))))}}..,))))))))))).)))))).{{.......})},....))).,)))))))))),....}).)..))))))).))))..)))..(((((,,(((((...)))))))))))......((((((((({.{(((.(((((.,,(((({(((({((((.,(((((((((((((((...(((.........)))...))))}..))))).....)))))|((({{{,.....||||.,....{{||,,}}}}{(((({((,((,.{((,.((....{(....,,.,|..}||}}.|,))}.))),,)})).})))))}....{||,.|||||{||||{{,||}|||{,,.(((((((((.((((((((((({((((((,,...((((((....))))))....(((((......))))).,((((,(((((((........)))).))).))))},{{{,(((((((((...{{(..((((((.((....)).)))))).})},,(((((((((((({,({(,..}))))})||,.(((.(((((((((((....)))...)))))))).)))(((.(((((.(((((.((.(.((((....)))).))).)))))))))).))).....)))))))))....(((((((.(((.((.(((((.((((((.....))).)))...,.)))).)).)))..)))))))(((({{{.{|{(,,,)))}.}}}))))},.)))))))))......))),..(((((((((.,...{{..,.,,,}..,}...,,,.))))))))))))))).)))))))))))((((((((.(((...((....))((((((((..((.,....((((((((((.......((((((((((((((((((.(((.((((..,,.({.....||.....((((.(((((((((((...........)))))...)))))).))))..(((.(((((((,.((((...((((((..((((...,,.(((((....))))).,,|{(((((,............)))))|(((((.((....)).)))))..(((((,,((.((((..(((((((....)))))))......)))))))))))).....((((((((..(((((((((...)))).(((((((((({.,((((((...(((((.....))))).....)))))).,.((.((((((.((..(((((..(..((((.....))))..)..).)))).))))))))}},,...{((((..((((((.......((((((.......))))))......))))))..{{.((({{.....,,.((..,,||..||....})))),)}})))))))))))))))....((.((.((((.....)))).)).)),......,...)))))((((....)))).)))))))).)).)).,)))))}..))))...},))))))).)))...,}..))))..))).))))))))))..................))))))))))),))))))),.))..)))))))))))))))))))......,.(((((.{(({....))}..))))),))))))))).,,||||||||({(((((,{{{({,,,,|||,,..}}.((((((......)))))).}}}}}))}}}}},}}||,({{((,,....}})))},..{||||{,.,{{{{...}})}{(((((((..(((((....)))))....))))))))||||{|||.,....))}}))))))))..}})))))},.}))}})))}|.||,,(((((...)))))....,({,.{||,{{{{....)})))))}})},))))).))}{{.((..(({......))).)).)),(((((..(((((((...((((((...(((((..{......,|..}|}}|((((((((((.{((((((,,{{(((.{(({,,,.}}}},||,....||||||,|}..})}}.)))}}}.))))))}.)))))))))),,|||{{(((..((((((.((.((....)).)).)))))).........))))))),}},....,,{.{{{{{...)))))..((((.((..((.((((((.((........)).)))))).))..))))))..))))))..(((((((.....((((((...(..((,....}))..).((((((((((((((((.(((((((.........((((((....(((({{{,,,.....}}}..,||(((((((((..((((((........))))))..))).)))))).)))).))))))....|.((((..........)))).}.)))))))))}}})))))))))))).))))))...))))))).(((....))).........)))))))...))))).,.})))))))))....))))).)))}..))).))))))))))..)).)....)).))))))))).((((((....)))))).......((.(((((,((,{{.(({,....,}}|||{{,,......},}.,,}}|{{{{.....))))),|..(((....)))..........(((((..(((.{((.((((.{.((.{.(((((.....(((....)))(((,{.{(((((((,,,,.((((.....}})),,...{((.(((((((.({((((({{...}},}))))(((((((((,.{{......,)).{||,.((((((((((.(((......))){(.(({{((,...}))))),))|.,(({..{({...{,(({(({{..,,{||,,..}}}..,},)}},,...))))...,},,.,.)))))))},)).,},...............,,....}}..||...}}))))))))}),.....(((((.((((.(((((.(((((((...(((..(((...)))..)))))))).....))..)))))))))))))).,.}).)))))))}}......(((({.,,,(((((.......)))))(((((.((.(((..((((..((((((....))))))..))))....))).)).)))))....}}}}),,..)))))))).})}}..,,..((((((............))))))..||,,{|{|||{,,.)|||||}...{||{{....,))))}))))).))).).)))).))}.))))))))))))).)).(((...(((((........)))))....))).

Transcripts

ID Sequence Length GC content
AGAUCCGGUCGCAGGCAGCGUCCAGCAUGGACUGGUCCAGGCACCUCCG… 3551 nt 0.5390
Summary

Although the function of this gene is not known, the existence of this gene is supported by mRNA and EST data. A possible function of the encoded protein can be inferred from amino acid sequence similarity to the E.coli FtsJ protein and to a mouse protein possibly involved in embryogenesis. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the FTSJ3 was down-regulated in brain tissue at 8 and 24 hours after whole-body irradiation with 10 Gy γ-rays, with fold changes of 0.433 and 0.406, respectively [Zhao et al. DOI:10.1158/1078-0432.CCR-05-2418]. In human patients with acute myocardial infarction, RNA-seq analysis of platelets showed the FTSJ3 had increased expression in ST-segment elevation myocardial infarction (STEMI) platelets compared to non-STEMI subtypes [Eicher et al. DOI:10.3109/09537104.2015.1083543].