Basic Information

Symbol
FZD4
RNA class
mRNA
Alias
Frizzled Class Receptor 4 CD344 Frizzled 4, Seven Transmembrane Spanning Receptor Frizzled Family Receptor 4 Frizzled-4 EVR1 Fz-4 FzE4 HFz4 Frizzled (Drosophila) Homolog 4 Frizzled Homolog 4 (Drosophila) Exudative Vitreoretinopathy 1 WNT Receptor Frizzled-4 Frizzled Homolog 4 CD344 Antigen FZD4S FEVR GPCR Fz4
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_012193.4
Sequence length
7387.0 nt
GC content
0.4624

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2396.80 kcal/mol
Thermodynamic ensemble
Free energy: -2541.89 kcal/mol
Frequency: 0.0000
Diversity: 1844.96
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((.((((((((((((((((..((((.((.....)).))))..))...))))))))))).(((((((((((.....))))))...(((((((((...((((((((((..(((....))).)))))........(((((((.(((.((((((((((((((((((((((((((((....(((((((.(((..((.(.(.((.(((((((((((.((.((((((((((((((...((((((((((....)).))))))))))))).(((((((((((((((.((((.(((...(((((((((((((((.((((((....)))).)).)))).))))))..)))))....))).)))).))).......)))))))))))).))).)))))).))))))))))))).)).).)))....))).)))))))...))))))..((((........))))....((((((((........)))....))))).......((((((((...))))))))..((((((((.(((...)))..))))))))...............(((.....))).))))).)))))).))))))).(.(((((......(((((.(((((....))))).)))))))))).)..((((.((..((((((((((....))))((((((((......))))))))((((....(((.(((..((((((((...((((..(..((((...))))..).)))))))))))).....))).)))..)))).(((........)))..)))))))).))))..((((((....)))))).......(((((.......)))))....)))).))).)))))))....(((((((..((((((((.((((........))))..((((((....((...((((..((((.(((((((((((((((((.((((...((.......)).....)))).))))))))))))))))).......))))..))))))....)))))).....((((((((...((....))((((....))))..(((((...............)))))...(((((((((...))))))))).(((((((..((((...))))))))))))))).))))((((((((((.((((((.(((((((......))).)))).(((.....))).)))))).))))))))))((((........)))).))))))))...))))))).(((((..(((...(((((((.........))))))))))...)))))...))).)).....)))))))))))))).......))).))))))))..((((((((((..((..(((.....)))((((((.....))))))((((((......)))).))((((.((((((....(((((((((....)))).)))))..........(.(((.((((.....))))))).)(((((((((((((((........((((((..((((((.((........)))))))).))))))...........((((.....(((((...(((((((((((((((((...(((((...((.(.(((((((((.(.(((((((..((((((((((((((((((((.....))).))))))..(((((((((((((...)))))....))).)))))......)))))..))).)))..)))))))).)))))))))...).))...)))))...))))))))))((.(((((.((((((.(.(((((((((((((....))))).....)).)))))).).)))))).....((((((((.((((((((((....((((((((((((((((((((....((((((((((((((((....(((((((((((.........((((((((((((((((((..(((((((((...)))))))))(((((....)))))))))))............(((((..((..(((((((((((.(((((((...(((((..........((((....))))((.(((.(((((((((((.(((((((((.((((..((((..(((((((..(((((.(((((((....((((...))))..((((.......)))))))))))))))).)))))))....(((((.....))))).)))).....)))).)).))).))))((.(((.......))).))..(((((.((........)))))))..))))))))...).)).))).))((((((.....(((((((((........)))))..)))))))))).............((((((.((..((((.((...)).))))..)))).))))....))))))))))))...((((((((..((((.........))))..)))))))).....(((((((.((((((..((((((.............))))))))))))......((((((((((((((.......((((((((((......(((((..(((.........)))..)))))......)))...)))))))..((((((((.((((((.((...((((((((((......................(((((((((.((.......((((((((..(((..((......))..)))..))))))))......)).)))))).)))..)))))))))).)))))))).))))))))))))))).)))))))....)))))))...)))))))))))..)).)))))..(((........)))...((((((((.....)))))))).................((((((((.(((((((.(.(((((....))))).))))((((((((.....)))))..))).....)))).))))))))...((..((((((((((((.(((((((((((........(((....((((((...(((((((((...................))))).))))..)))))).))).....((((.(((((((((.((((((((.........))))))))))))........)))))...))))((((.....))))...((((((.(((((((((((......)))))))))))..((....((((....)))).))......))))))..)))))))))).(((((((((((((((.....(((((((((((..(((((((..((((((((((((.((..((.....(((.....(((((.(((....))).)))))......))).....))..)))))))))))..................)))..)))))))...))))))))))).((((((.......)))))).................)))).))))))(((....)))...)))))).))))))))))))..)).......)))..)))))))))..))))))..)))))))))).........(((((((((((((((((.........))))(((((((((.......)))......))))))..(((((((....((((((.(((.(((((.............(((((...(((((((.(((((((((((......))))))))))).)))))))..((((((((((.((((((....)))))).)))..........((((((((..((((((((.(((..((((((....((................)).....).)))))..))).)))))))).................)))))))).....)))))))((((((..((...))..)))))).))))).............)))))))).))))))....(((((((((.......)))))))))(((((((((.((((....)))))))))))))((((((...((((((...(((.((((((((....((((..((((((....(((..((((((((..........((((.((.((((.(((((((((..(((((((((((.(((((((((((((((.(((....((((..((((((((((((.((((.(((.((((((((.((....((((((((...))))))))......))..)))))))).))).)))))))))))..)))))))))...)))))))))..((.((((((((...........)))))))).))....((....((((((((.(.((((.(((((..(((((....(((...)))..)))))..))))).))))...........((((((..((.((.((((.((.((((((((.(((...(((((((.(((((....(((((....(((((.(((((((((((...((((((...((((((((.(((((..(((((...((((.((.((((((...((.(((.(((((((((........(((((((...))))))).........((((((((((((.....(((((((((.((((((((...))))..))))(((((((((((((..((........))....)))))).)))))))((((((((..(((((....((((.((((((((((........)))))))...)))...))))...)))))...((((((((((.((((.(((........))).)))).))))))))))............))))))))(((.....))).........)))))))))(((.(((((...(((((((.(((..((((......)))).....((((.((((((((((.(..(((.....)))...).))).))).)))).))))..............(((((......))))).)))))))))).........................))))).))).(((((..(..((((((.((((.(((((((((((....(..(((((((.((((((((((((..(((((((((((...(((....)))...((((....))))((((((((.((((((((((.((..((((..(((.(......).)))..))))...))))))...))))))..)))))..(((.((.((((((((.(((.......((((((((.((.(((.....))).))))))))))..(((((.......))))).........))))))))))).)).))).))))))))))))))......(((((....)))))((((.(((..........)))))))(((((((.(((((........(((.....)))))))).)))))))))).))))))))))))))))..).)))))))))))....))))))))))..)......))))).(((((.....))))).)))))).))))))((((((...((((((.....))))))...))))))........))))))))).))).))...........(((((((...))))))).........)))))).)).))))......))))))))))))))))))...))))))....).)))))))))).((((((.((...)).)))))))))))....)))))...(((..(((((((((((...((((((((((((......(((((.....)))))...........((((((.((((..((......))..))))...)))))).((((.(((.......)))))))...((((((((((((........)))))..)))))))))))))))....)).))...)))..))))))))..))).((((((....(((.((((............)))).)))....)))))))))))...))))))).((((((((...))))))))....(((((((((((....((((.((((..(((..............))).(((((.(.(((((((..((((..((.((((.(((...)))))))))......((.(((((....)))))))..(((((...........)))))....))))..))))).))..).)))))..((((..........))))....)))))))))))))))))))((((......)))))))))))))))))..)))))).))..)))))).).)))))))).....))))))))))).)))))))))))...)))))))))...(((((((((.....)).)))))))..)))).)).))))....((((((((((.........(((......))).........)))))))))).)))))))).)))..))))))))))....)))))))))))...........(((((((((........))))))))).......(((.(((((...)))))))))))))).)))))).)))))))))))......)))))))))))))).))))))((((((((((........))(((((((((...(((...(((..((((......))))..)))))).)))))))))........(((((......(((((((..((....(..(((((......)))))..)..))..)))))))))))).))).))))))))))))))))))..)))))))............))))))))).....).))))))))..((((((((...))))))))....((((..((....))..))))...........))))).)).........((((........))))))))))).)))))...)))))))))))))....))))))))))))))))((((((.((((((((...((((.((((..(.(((((((((((........(..((.(((((((..((((....((((((((((.(((((((((((.((.......))..))))))))))).).((((((.(((....(((((((((((((((((((((((.....)))))))((((((...(((((........)))))..)))))).((((.....))))))))))))))).)))))....((((.......)))).......((((....((((.....)))).))))((((.....))))....((((.....)))))))))))))..))))))))).))))..)))...)))).))..)))))))))))).)..))))....))))(((.((((.......)))).)))......(((....(((((....)))))...)))..)))))))).))))))..((((((((....))))))))))..)))))).(((((((((((((...)))))).))..))))).................((((((.....))))))))))((((((......)))))).
Thermodynamic Ensemble Prediction
((((((((.(((({((((((((({({((((({{((((..,.})}})..})}.,,)))))))))),|||{{((((((.....)))))))}}|{{(({{{{,,,|||{((((((..(((....))).))))),.......(((((((.(((.((((((((((((((((((((((((((((.,..(((((((.(((..,{.(.(.((.(((((((((((.((.((((((((((((((,.{((((((((((....)).)))))))))})),.(((((((((((((((.((((.(((,..(((((((((((((((.((((((....)))).)).)))),}))))}.,)))))..,.))).)))).))),......)))))))))))),})).)))))).))))))))))))).)).).)})}...))).)))))))..})))))),.((((........)))).,..{{((((((.,......))).,,,}}}}}.....,.((((((((...))))))))..((((((((.(((...)))..)))))))),.......,}.,...{{{.....}}}.))))).))))))},))))))...((((({,((({(((((.{{((,(({{{{{.|,,,,,|,,,,,.}..,,{{,{|}}||||,|}||{((({((((((((((((......)))))))),|}|...}|||}{,{..((((((((...((((..(..((((...))))..).))))))))))))....})))}))),.||||...,,,}}}||.||{{.|||,,,||{,,||..((((((....)))))).,,..}}||||.}}}},,.}))))}}}})))).))).)))))))..,,{((((((..((((((((,((((,,..,,,{|||,{.((((((,,,.,,,{,((((..((((.(((((((((((((((((.((((...{(,......)).....)))).))))))))))))))))).......})))..}))),},...}})}}|.,,{,{{{{{{{(,..,,....,,{{((,...}}}).,{{(((,|,,,...,......,}}}}|,.(((((((({...})))))))).(((((({..((({...})))}))))))}}}}||||}((((((((((.((((((.(((((((......)))}}))).(((.....))).)))))).)))))))))){|{{......,,)))).))))))))...}})))|}|((({(,,{((...{(((({{,....,,,,}}|}}}}||}.,.|||}}..}))),}},...,))))))))).,}}}.......))).))))))))..{{{{,{{{{{{,{,..(((....,}}}||||||....,((|,{((,{{.,,,,.,})||||,}||,({(((((({,.,(({((((((....)))).)))||...,,,....{.(((.((((.....))))))).|(((((((((((((({.......{((((({,,(((,.{{((.....{{.|}||||||||}||||{{{,,.....,,..(((..(((({....}))))..)))..,,,{,||||||{{,,...{{|||,{{}}|{.,{{((((|,,,|)))))),|}},,}||}}}}.{{{{|||.||||,|({(((((({{{{......}},,,,.{{{{{.||||{..{{{{{({{{{{{.((((,{.,..{{,.|||,,)))}.),,})})))}}))......)))))..)))}},{({.,.((((((.(.(((((((((((((....))))).....)).)))))).).)))))).})),,,,},,,((.(((((((((,,.,((((((((((((((((((((....((((((((((((((({...,(((((((((((....{{...{((((({{{{{{{{{{{{{{(({((((({...})))))}||{{,.{|||||}|{{||||||.....,...,,,{((((,,,{{{((({,,{{{{{,{{{||,,..}||,||..,......{{(((....}}}}.,.((({(((((({{{{{.(({((((((.(({,........,{,{{{{(((((,,.,((((((....|||}}}.{{({{,((((,,,,,,.}}}}}},.,}|||(({{..,{({{,...,})}})}}}.,,,||.||||||||||||}{||.}}},||||(({(((.{,,,..,}}.}),,(((((.((........)))))))..)))))))),},,.))},))}))||||||,,.,,((((,((((........)))))..)))),,,}},.........,,,,}}))}),|}}}||{|}||,.,}}.}}||,......,}}}}...)))))),)),}....((((((((..((((.........))))..)))))))).,,{{{((((({.((,(,({.((((((.,,....,,,...)))))).)),).}},.})}||,||||||,((({{{,.{{(,(((((((({,....(((((..((({......},))}..)))))........,...,|||||,..(((,(((({,,,,((((,.,.(((((((.,..............{(((({{{{(((((((((.((.......((((((((..(((,.((......}),})))..))))))))......)).)))))).)))..)))))))))..,}||}||{{{{|||||..,,})}.,)))))))...,)))))))}..,)))),,,,,,}}))},))))}}}}...||....,,|{{.((((((((.....))))))))..}}}.............(((((((.(((((((.(.(((((....))))).)))){{{({{{(,,.,,|}}}),,))),....)))).))))))){{{{(({{(({({{{{,{(({({{,,,,|||},...,{{{{{,({{{(((((((({(((((((((..........||,,.....}}))})))))...,,.|{{..(((((...}}}))..}||(,{((((((((.......,.))))))))))}}.,,,,}}},,.,,....,))||||......}))}}}),,}.}}||{((((((((......)))))))))})}))))}})),,,.{{{{.((.{({....)))..)).}))).,)))))}}))),,||||.|}}}}}},.{{|||||||||},(((((((,{{{((((({{{{{.{{..||,,,}}|||,}...|||{{.{{{..,,|||.,}|||,,.,,{||,.....,|,,||}}|||}}},.,}}..}}}}}..,}},,.))))))))))),,.})))||||}}}.||||||,...,,,||}}},,.......,||,..,,,,,,,.,,.,|(((,...)))).,.|}}}},.,}}},,})))},.,,,.......}))..})))))))),}))))))..)))))))))).........(((((((((((((({{{....,,,..,))){((((((((.......))),.....})))))..(((((((....((((((.(((.(((((.,{.,.,,.....(((((...{((((((.((((((((((,....,,)))))))))))}))))}},..((((((({((.((((({....}))))).))}.....,....((((((((..((((((((.(((..((((({.,,.((...,{,....,},...))...,,),)))))..))).)))))))).................))))))))...,.))))))){(((((..{{...)}..)))))}.)))))....,,.}}.,,.)))))))).))))))....(((((((((.......)))))))))(((((((({,((((....)))))))))))))((((((...((((((...(((,((((((((....((((..((((((.....{(..((((((((....,(((,(((((.,...{{,.(((((((((..(((((((((((.(((((((((((((((((,(({{((.(((((((,,,,,||||}}|,|}|{({(,{(((,,.(({,{.,((((((({{{,||,,,,....}}.))}}))))))))})))}})))))),)))}})))|||{{|,{,|.,,}}))),.((.((((((((.(.......,.)))))))).))..,,||,,..((((((((.(.((((.(((((..(((((...,{{{...}))..)))))..))))).))))...,,,.....((((((..((.((.((((.((.(((((((({((,((,{((((((.(((((,,(,(((((....(((((.(((((((((((.,.((((((.,.((((((((.(((((..(((((...((((.((.((((((...,(.(((.(((((((((.{{,{{.{(((((({...})))))}}}.}.,,,,((((((((((((,,,,,(((((((((,{(((((((...)))).}))}}(((((((((((((..{{........)}....)))))).))))))){{((((((..(((((....((((.((((((((((.,....,.)))))))...)))...)))}...)))))...((((((((({.((((,(((.......,))).)))).}))))))))).,........}.)))))}||(((.....}}}}},...,,.)))))))))||||||(((.{.(((((((.(((..((((......)))).....((((.(((((((((({...(((.....)))...)}))).))).)))).))))..............(((((......))))).)))))))))),},}},.................,{|||.......{|||{..{..((((((.((((,(((((((((((....{..(((((({,((((((((((((..(((((((((((...{((....))}...((((....))}}((((((((.((((((((((.,,..((((..(((.(......).)))..))))...}}))))...))))))..)))))..{((.{{.((((((((.(((.,,.{{{((((({{{,{{.{({,,...))),)))))))))}..{{(((,,.....}}}}}...,},}}}))))))))))).}}.))}.))))))))))))))..,{,.(((((....))))),,||,,{,,{{.......,))),),{((((((.(((((........(((.....)))))))).))))))})))}))))))))))))))))..}.)))))))))))....))))))))))..)......}}}},.{((((.....))))).))))))}}))))),(((((...((((((.....))))))...)))))}........))))))))).))).,,.......,,..(((((((...)))))))..,,.....)))))).)).))))......))))))))))))))))))...))))))....).)))))))))).((((((.({...}).)))))))))))....)))))...(((..((((((((.({.{((((({(((({({......{((((.....))))),,,...,....{|||||,||||,.{,......||,,|}}}...)})))).((((.(((.......))))))),,{((((((((((((........))))}.,))))))))))}}}}}..,,,,..},,.)))}.))))))))..))).((((((...{((((((....})))))),..)))))),}.,)))))})})))))))})}},}}}.((((((((...))))))))....{((((((((((....((((.((((.{((,.....|,.......||,.(((((.{.{{(((((..((((.,((.((({,(((...)))))))))......((.(((((....)))))))..{{,{{,{{.,,,....))))}}},.))))..))))).})..}.)))))..((((..,.......)))).}}.))))))))))))))))))|((((......))))}..})))))))))..)))))).))..)))))).}.)))))))).....,,})))))))).)))))))))))...))))))))){{{(((((((((.....)).))))))}...,,..}}}(((((....))))),{{,...((....)),.....,},,......))))),)))))...)))))))).}},..))))))))))....)))))))))))...........(((((((((........))))))))).......(((.(((({...}))))))))))))).)))))).)))))))))))......)))))))))))))),)})))),,{(({{({,..,}}|,.}}(((((((((...{({...{((..((((......))))..)))))}.))))))))}........,((((......(((((((..((....,..(((((......)))))..)..))..))))))),,,),.)))),,}},))))))))))))}},))))))).....,,..}},))))))))),)))))}))))|||||}((((((({...}))))))).,||{{{{..||..,.))..))),,}},,,}}.,.,)),,..,,)}}}..,}|{{,,,|}|}},}.,|||||{||.|||}},.,}}}.})))))))|...,)))))))}||||||..{(((((.((((((((.{{((((((,(((((.(((({{{,|||,...,......,,.(((((((..((((....(((((((((,.{((((((((((.,,.......,),,))))))))))}.,.(((((({(({,...(((((((((((((((((((((((,,,.,||}}||{({{{{{...(((((........))))),,))))))}||||,,..,,.})))))))))))).)))))....{(((.......)))).......((((....((((.....)))).))))((((.....))))...{((((.....)))))))))))))..))))))))).))))..)))...))))}))}}.)))))}}||||{},.|}}},...,}}|(((.((((.......)))).)))......{||,..{((({{....}),)))}.))),.)))))))).))))))..))|}||||....))})))))))}}},}})}}|||||,{((((({...,))))},,},.))|||{{.{{,{{..,,|....((((((.....)))))))),,|,,,,,}}}}}.)))))..

Transcripts

ID Sequence Length GC content
GAGAGCUGCGCAGCGCUGGCUGCUGGCUGGCCUCGCGGAGACGCCGAAC… 7387 nt 0.4624
Summary

This gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. This protein may play a role as a positive regulator of the Wingless type MMTV integration site signaling pathway. A transcript variant retaining intronic sequence and encoding a shorter isoform has been described, however, its expression is not supported by other experimental evidence. [provided by RefSeq, Jul 2008]

Forensic Context

A study in Sprague-Dawley rats demonstrated that the mRNA encoding the FZD4 exhibited the highest intra-group homogeneity for wound age estimation among three tested markers, as evidenced by its lowest sum of variability scores (23), the smallest coefficient of variation (21.01%), and the smallest relative average deviation (14.44%) across post-contusion intervals from 4 to 48 hours [Zhu et al. DOI:10.1016/j.jflm.2016.07.013].