| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAAAUUCGUGGAUCGCUCCGCUGAAUCCGCCCGCGCGUCGCCGCCGUC… | 1319 nt | 0.4882 |
Gamma-aminobutyric acid A receptors [GABA(A) receptors] are ligand-gated chloride channels that mediate inhibitory neurotransmission. This gene encodes GABA(A) receptor-associated protein, which is highly positively charged in its N-terminus and shares sequence similarity with light chain-3 of microtubule-associated proteins 1A and 1B. This protein clusters neurotransmitter receptors by mediating interaction with the cytoskeleton. [provided by RefSeq, Jul 2008]
A study in the Australian sheep blowfly *Lucilia cuprina* identified the GABARAP as a homolog present within a large expressed sequence tag collection, where it was categorized as a target protein associated with insecticide resistance [Lee et al. DOI:10.1186/1471-2164-12-406].