Basic Information

Symbol
GABARAPL2
RNA class
mRNA
Alias
GABA Type A Receptor Associated Protein Like 2 GATE-16 GEF2 GATE16 ATG8C ATG8 Gamma-Aminobutyric Acid Receptor-Associated Protein-Like 2 GABA(A) Receptor-Associated Protein-Like 2 Golgi-Associated ATPase Enhancer Of 16 KDa General Protein Transport Factor P16 Ganglioside Expression Factor 2 GEF-2 GABA(A) Receptor-Associated Protein Like 2 MAP1 Light Chain 3 Related Protein MAP1 Light Chain 3-Related Protein FLC3A
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_007285.7
Sequence length
974.0 nt
GC content
0.4384

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-272.30 kcal/mol
Thermodynamic ensemble
Free energy: -293.84 kcal/mol
Frequency: 0.0000
Diversity: 303.22
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((..((.(((.((.((....)).)).).)).))(((((((((.((((((....))))))..((((((((((((.....(((((((((((((...((..((((......))))..))..)))).))))........))))).......))))))).)))))((((...(((((((....(((....)))...(((((((..((((...((..(((((..(((.(.(((((......))))).).).))..)))))..)).))))..)))))))((((((((((((....(((...(((...(((((((((.(((((((((...(((((..((((((.......)))..)))..((((((.(((........))).)))))).)))))...))))))).........)).)))))))))....(((((((.((((.(((((....))))).))...)).))))))).(((((((.((((((((.((....))..)))))))).))......)))))(((((((..((((((((((...(((((((((((((((((..(((.........)))..)).)))))...((((((((((((((((....(((((((.(((.............((((((...........(((.....))).....((((.(....))))))))))))))..)))))))....))))))...))).)))))))..(((((....)))))...)))))).))))..)))))...)))))....)))))))..(((..((((((((.....((...(((((((.(((.((((((.(((..((((.....)))).))).)))))).)))..)))))))))....)))))))))))...)))...)))....)))))))))))).))))))).))))......(((.....))).......)))))))))...............))).
Thermodynamic Ensemble Prediction
....((({{{(,{((.((.{{.,,.}).}}.||||.}|{((((((({.((((((,.,,|}|}}|,.{(((((((((((..,,|(({{(((((((((...((..(({(......))))..)}..}))).))))....,,,,))}}}.,.....))))))).))))).,{,.,,{||||{,....(((....))),,.(((((((.,{(((...((..{((((..{((.(.(((((,....,))))).},|||}..}}}}}.,)).)))},.}}}}))){((((((({{||,{{{||{{|||.,,..(((((((((.(((((((((...{{(((..{{{(((,.,,,,,|}}..}}}|.((((((.(((........))).)))))).))))),,,))})))),......,,}}.)))))))))....(((((((.{(((.(((((....))))).))}..,).))))))).((({((((((((((((.({....}}..)))))))}.,,...,))))))),.{(((((.((...(((((.,.((((((((((.,,{{.....,{{({{....})},}}}|{,,|||,..{{{{{{{{{{((((((....(((((((.{((,,.{,,.......,||{{{||,,..,,...{{{.....},,...,.((({,{....}))))}}}}},}}}..)))))))....))))))}|,}||,||}}}}}.,|||{{.,,.}}})),..)))))).)))).,)))))..}).)))))}|}..|||},}{{{,.{(((((((.....((...(((((((.(((.((((((.(((..{,{{.....}})).))).)))))).)))..)))))))))....))))))))}}|,,||},,,..,}},)}))))))))))}}.,,})))).}}}}..,,,..,{....,}},.......}})))))}}...............))).

Transcripts

ID Sequence Length GC content
AGUCGCCGCCGUCGCUGCCGCUGCCGCUGCCGCCGUCGUUGUUGUUGUG… 974 nt 0.4384
Summary

Enables phosphatidylethanolamine binding activity and ubiquitin protein ligase binding activity. Involved in negative regulation of proteasomal protein catabolic process and protein localization to endoplasmic reticulum. Located in Golgi membrane and autophagosome membrane. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in humans identified the GABARAPL2 as a hub gene within a robust, validated gene coexpression network (blue network) associated with cocaine use disorder in dorsolateral prefrontal cortex neurons, where it is implicated in GABAergic signaling [Huggett et al. DOI:10.1523/Jneurosci.2879-19.2020]. In mice, chronic methamphetamine administration significantly dysregulated the GABARAPL2 in microglia, where it is involved in autophagy and mitophagy pathways [Oladapo et al. DOI:10.3390/Ijms26020649].