| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCGCCGCCGUCGCUGCCGCUGCCGCUGCCGCCGUCGUUGUUGUUGUG… | 974 nt | 0.4384 |
Enables phosphatidylethanolamine binding activity and ubiquitin protein ligase binding activity. Involved in negative regulation of proteasomal protein catabolic process and protein localization to endoplasmic reticulum. Located in Golgi membrane and autophagosome membrane. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans identified the GABARAPL2 as a hub gene within a robust, validated gene coexpression network (blue network) associated with cocaine use disorder in dorsolateral prefrontal cortex neurons, where it is implicated in GABAergic signaling [Huggett et al. DOI:10.1523/Jneurosci.2879-19.2020]. In mice, chronic methamphetamine administration significantly dysregulated the GABARAPL2 in microglia, where it is involved in autophagy and mitophagy pathways [Oladapo et al. DOI:10.3390/Ijms26020649].