Basic Information

Symbol
GABBR2
RNA class
mRNA
Alias
Gamma-Aminobutyric Acid Type B Receptor Subunit 2 GABABR2 GPRC3B HG20 GPR51 Gamma-Aminobutyric Acid (GABA) B Receptor, 2 G-Protein Coupled Receptor 51 GABA-B Receptor 2 GABA-B-R2 GABA-BR2 Gb2 Gamma-Aminobutyric Acid B Receptor 2 G Protein-Coupled Receptor 51 GABA-B Receptor, R2 Subunit HRIHFB2099 EIEE59 NDPLHS DEE59
Location (GRCh38)
Forensic tag(s)
Forensic psychiatry evaluation Drug abuse diagnoses

MANE select

Transcript ID
NM_005458.8
Sequence length
5499.0 nt
GC content
0.5334

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1900.72 kcal/mol
Thermodynamic ensemble
Free energy: -1997.15 kcal/mol
Frequency: 0.0000
Diversity: 1131.48
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((.(((((...(((((.((.((....)).)).))))).((((((.((...))))))))....))))).))))))(((.((.(((((((((((((((..((((((((((.(((((..(.(..((((((((((((((((.((((((........((.((((....).))).))(((((.(((((((((.(.(((...))).).)))))).))).))))).)))))).)))))))).))).)))))..))..)))))))))))))....((....)).((.((....)).)).))...)))))))...)))))))).)).)))((((((.((......(((((.((((.((.(((((((((.((((....(((((........)))))....)))))))))...)))).))...)))))))))..)).)))))).((.((((((((((..((...((((((((.(..((((.(((...................(((.(((((...((((((((..((((....)))).((((((((...((((....................)))).))))).)))...(((((((((((...(((((((...((((.............(((((..((((...(((((((.(((((((((((........))))).))))............((((.((((((...........))))))))))(((((.............))))))).))))))).......(((((((((.((.((.((...)).)).)).)))))).)))((((.....))))..))))..)))))..(((((((((..((.....)).))))))))))))).)))))..))..)))))))))))((((...))))..............)).))))))...))))).)))))).))))))))))))).))..)))))))))).))(((((.((((..((....(((((.(((((((.(((.(((.(((((......((((((........(((((((.(((((((.((((...((((((((((((((((((((((.....((((.((..............)).)))).....)))))))).)))))).))))))))......((.((((.((((......)))).)))).))........)))).))).)))).)).)))))..(((((.((.(((((((((........(((((..((((...(((((((...((.((...)).))(((......)))..)))))))..)))).....))))).(((((((..(((((((.((((((((((.((.((((...((((((.....((((((((((.....((((...((((((.((.(((((((((.....((((...((.((.((((((.((((......))))..))))))...))))..))))...((((.((((..............)))).))))........((((.(((((.((..((((((......(((((((..((......(((((((.((...........(((((((((.((((..........................))))))))))..)))..)).))))))).....)).)))))))...))))))..))))))).)))).))))))))).)).)))))).((((((((((((.......)))).........(((((((((....((((..(((................)))..))))...((((((...))))))..(((((((((((((((((((((.((((((((......(((.((.............)).))).......))))))))...(((((((((..((((.....)))).((.(....).)).((.((((....)))).))))))))))).....((((((............))))))....(((((.((((.(........).)))))))))..(((((((((((((((((.......((((....(((..((.(((((..((((((.(((..(((((((....(((((((((.((((.......((.(((...((((...(((...((((((...((((......)).))..)).))))...))).........(((((...(((((.....)))))....(((((........(((((((((((((........(((((((....(((.(((..(.(((((((((((((.(((...........)))...))))))).........)))))))))))))...((((((((.(((.......((((((...(((.((((((...(((.(((((((...((((((((..((((..((..((((((((((....(.(((((((((((((.((((...)))).((((......))))..........(((((((..((((((....((((......((((((.(((((((...........)))))).....(.((.....)).)....).)))))).......((.......))((((((((...((((((.............(((.((.......)).))).(((((((......(((((.(((....((((..(((((..(((...........................................(..((((.(((..((((......))))....))).))))..)...(((.((((.....................)))).)))....))).)))))...)))).........(((....)))................((((.....))))..)))))))).....)))))))...))))))))))))))..............((((((((.((...........)))))))))).))))..))))))......))))))).((((....((((((....))((((....)))).....(((.....)))...))))...))))((((.(.((.(((((((((.(...).))))))))))).).))))......))))))))))))))..))))))))))....))..))))..)))))))))).))))).)))....))))))))).)))))).((((.(..(((.....((((((.((((((((((((((((((((((.(((.((((...(((..((((.(((((((((.........)))))))))...))))..)))...)))).(((((.((((.............)))))))))((((...............................................))))......(((((((((((((....((.(.(.(((((((((((((((.....((((....(((((((((((.(...(((...)))...))))))))............(((....((((.((.((((((((..((((((......((((((((((((((((((((((....))))).((((((......))))))..(((((((..(((((.((.(((((((((.((((((((((((((((.(((((((.(.((......))).))))))).((((....(.((((.((((..((((.(((.....(((((....))).))....)))))))..)))).)))).)...))))....((((......)))).((((....))))..(((((((...((((((..(((......)))..))))))..((((.....((((...))))))))..)).)))))...))).))))..)))))))))..)))..)))))).))..)))))(((....)))..(((......(((((....))))).)))...((((((........))))))........(((........)))(((....))).)))))))...............)))))))).((((((........))))))((((.(((..((.((((((....((((((((.(((..(..(((((((((..((((((((((((((((.((.((((...))))..)).)))))))..........))))))))).)))))))))..)..).)).)))))).))....)))))).))..))).))))..........)))))))))......))).......)))..)))))))))).))))..)))..(((((........))))))))))))))))))))....)))))))).).).))...)))))))))))))..)))..))))))))).))))...((((.......))))....))))))))).)))))).(((((((...((((((((((((...))))))))...))))...))))))).)))..))))).))).))))))))....(((((..((((...))))..)))))....(((((((.(((((.(((((.(((...((((..(((........))).))))..)))..)).))).))))).))))))))))))))..........(((((.(((.((((...((((((...(((.......)))..))))))...)))).))))))))...)))))))))))))........))))).((((....(((((.(.((((....)))).).)))))...)))).)))))....)))).))).))......)))))))))))))....))))).))...))).))))))............))))).))..)))..))))......))).))))))........))))))))....))))))))))).)))))))))).)).)))))))))))))))....((((....))))....)))).))))))))))....))))))...))..........((((.((.(((.....))))).))))((((......))))(((((...........................)))))..............(((((((..(.((((.......((((((...))))))....................(((((....................))))).............((((.((.((..(....)..)))).)))))))).)..))))))))).)).))).))))))).)))))))..))))..))).....))))..))))).)).)))))....((((((......................))).))).......(((..(((....)))..))).)))))).....))))).)))...))).))))))))))))...)))))))))))...((((....))))...((((..(((((.((((...((((.......))))....))))...))))).))))..............((((((....))))))...((........))..)).......((((((((......))))))))........
Thermodynamic Ensemble Prediction
((((((((.(((((,,,(({((.((.({....)).)).))))).((((((.((...))))))))....))))).))))))(((.((.(((((((((((((((..{,(((((((,,(((((..{.,..((((((((((((((((.((((((...,{,..{{.|({|,...,.})).))(((((.(((((((((.(.(((...))).}.)))))).))).))))).)))))).)))))))).))),}))))..}}..)))))))))))))....((....||.{{.{{.||.}}.)).))...)))))))...)))))))).)).)))((((((.((......(((({{((((.((.(((((((((.((((....(((((........)))))....)))))))))...)))).))...)))))))))}.)).)))))).((.((((((((((..((...((((((({,(..((((.(((.................,.(((.(((((.,.((((((((,{((((....}}}}.,{((((({...(({{.......,............}))).}}})).}}|..,(((((((((((.{.,,(((((.,,{(((|,,........|}(((((..{(({...((((((({(((((((((((........))))),,))).,...}}}}}))||((.((((((.,,.....,}.))))))))||{,{{{,,..{{{{{..,{|}||||,.,}))})),,}}}}}{{{((((((.((.((.((...)).)).)).)))))}.}}}||,|,..,.))}}}|)})}..)))))..{((((((((..((.....)).))))))))))))),)))))..}},.})))))))))){{(|,..})))...,,.....}}}.}}.))))))...))))).)))))).))))))))))))).))..)))))))))).))(((((.((((..({....(((((.((({,(({(((,((((((({{..,,.{(((({{...,,|||(((((((.{((((((.((((...((((((((((((((((((((((.....((((.((...........}.,)).)))).....)))))))).)))))).))))))))..|||,((.((({.{{{|......)))).)))).)).,,,....)))).))).)))}.)).))))).,(((((.((.(((((((((........((((({.((((...(((((((...{{.(({{{||..,,||..}}.}))}.,)))))))..))))..},,,)))).((({(((..(((((((.((((((((((.{(,{,{{...{({(((.....((((((((((.....((((...((((((.((.(((((((((....,{,.{{{.((.(({(..{,,.,,,}.)))}.}}},}},.(((((.,{,.{(({{{((,,({.(((((...))))}...}}..)))},))))...))))){(((,(((((.((,.((((((......(((((((..((......(((((((.((..,,....|..{{{(((((,,((((..,.....................,,))))))))))..}))..)).))))))).....)).)))))))...)))))),})}))))).)))).))))))))).)).)))))).{(((((((((((,......,})),..,},...{(((((({(,...((((..({(,.......,,......}}}..)))}...((((((...))))))..(((((((((((((((((((((.((((((((..,...{((,((.,,........,.}}.}}}.......)))))))).,.(((((((({..((((.....)))).((.(....).)),((.((((....)))).))))))))))).,.{.((((((............)))))).,..(((((.((((.{........).)))))))))..(((((((((((((((((.......((((....(((..((.(((((,{((((((.(((..(((((((....(((((((((.((((....{{{(({((,.,.{{({,..(((...{(({{{...((((......)).))..}|,)))}...)))...,}....}}}))}}}(((((.....)))))....(((((.....,..(((((((((((((......,{{{(((((....((,.{{{..{.(((((((((((((.(((...........}))...))))))}.......,,)))))),,)))))...{(((((((.(((,,.....((((((...(((.((((((...(((.(((((((.,.((((((((..((((..((..((((((((((....{.(((((((((((((.{(((...}}},.((((......})))..........(((((((|.((((((....((((...,..{{{{....((((((...........)))))).....{.,,..,,.||{{{{..,.)))}})}..,...||.......||((((((((...((((((.{,......,,..{{{.{{.,.....)).}}}.(((((((......(((({{(((,,..(((({.(((((..(({...........................................(..((((.(((..((({......))))....))).))))..)...(((.((((.....................)))).)))....})).))))).},}))).........(({....)))............,,,.,,,,...,,),,,..)))))))).....))))))).,,))))))))))))))}.............((((((((.((...........)))))))))).}))).,))))))..}}..})))))).(((({...|{{{(({{{{({({({.,,,}|}|{{,,,{{,...,{|||....,},}}})))}||||.,,))}|||,|||||}}...,})))),,,,,,,{{{,,,,...}}})))))))))))))}..))))))))))....))..))))..)))))))))),})))).)))....))))))))).)))))).,,{{,||,||||....((((((.((((((((((((((((((((((.(((.(((,...(((..((((.(((((((((.........)))))))))...))))..)))...,))).(({({{((((.............))))))))),{({.....,...{|{{,.................................,,.,.,,,}.(((((((((((((....((.{.(.(((((((((((((((.....((((,,..(((,(((((({,(...(({...}))...)))))))).,,,,..,.....}},,|}||{{.|(.{((((({(,,((((((,.....||||||||(((((((({(((((....))))).((((((......))))))..(((((((..(((((.((.(((((((((.((((((((((((((((.(((((((.(.((......))).))))))).((((.{..(.((((.((((..((((.(((....{((({(....}}}.))}}..)))))))..)))).)))).)...))))....((((......)))).((((....))))..{((((((...,,{(({..{{{.(((((((.....))))))).......,|{|,,,,)))).}}}..)).)))})...))).))))..)))))))))..))),.}))))).))..)))))(((....})){,,{,..,|..(({{(,,,,|}|}|,||,...((((((........))))))........(({........}}|(((....))).)))))))...............}))))))).((((((........))))))((((.(((,.((.((((((.,..((((((((.(({..(..(((((((((..((((((((((((((((.((,((((...)))}..)).)))))))..........))))))))).)))))))))..)..).)).)))))).))..,.)))))).)).,))).))))..........))))))))}......))),......)})..}))))))))).)})},,}}}.}|{(((.......,)})}))))))))))))))))....)))))))).).}.))...)))))))))))))..)))..))))))))).))))...{{{(.......))}}....))))))))).)))))).{{(((((||.|||||{{{{{{,...})))))}},,.||||...|||||||.,,,..}})}),))).)))))))}..,,(((((..((((...))))..))))),,,,(((((({.(((((.(((((,(((...((((..(((........))).))))..))}..}),))).))))).}))))))))))))),,........(((({{(((.((((...((((((...(((.......)))..))))))...)))).)))))))).,.)))))))))))))..,.....))))).,{{{....(((((.(.((({....}))).).)))))...}}||.||||,....}}},.,}}.))......)))))))))))))....))))).))...))).))))))........,,..))))).))..)))..))))......))).)))))),.......))))))))....))))))))))),}))))))))).}).)))))))})))))}}....{(((....}))}....)))).))))))))))....})))}}..|}|...,,,.,,.((((.{(.(((.....)))}}.)))){||{......)))),..,{|,,,.......................,,}},...,.,,.,.,|{.(((((((..{.((((.......((((({...})))))....................,,|||..........{{{{.{{...)),))},...........{{{|.|{,||..{,...},.,}))})))))))).)..))))))).}.}).))).))))))).)))))))..)))}..))).....))))..))))).)).)))))...}|||.((.,...,.............,}})))}).,,,.,,,.,((,{{{,..,{{{|......},))))}..}))}))))))}}},}.)}))))))))))))...)))))))))))...((((....))))...((((..(((((.((((.,,(({(,......}))}.,,.))))...))))).))))....,,....,,..{(((({....}))))),,,.,........}}||,|{{{{{..,{{|||||,.,,,.}})))))}........

Transcripts

ID Sequence Length GC content
GAUCCGUCACGGGCGCCGCCGCUGCCGCCGCCGCCGCCGCGGCCGUUCU… 5499 nt 0.5334
Summary

The multi-pass membrane protein encoded by this gene belongs to the G-protein coupled receptor 3 family and GABA-B receptor subfamily. The GABA-B receptors inhibit neuronal activity through G protein-coupled second-messenger systems, which regulate the release of neurotransmitters, and the activity of ion channels and adenylyl cyclase. This receptor subunit forms an active heterodimeric complex with GABA-B receptor subunit 1, neither of which is effective on its own. Allelic variants of this gene have been associated with nicotine dependence.[provided by RefSeq, Jan 2010]

Forensic Context

A study in humans using RNA-seq data from brain tissue demonstrated that the GABBR2 is involved in GABA receptor activation and morphine addiction pathways and was identified among 99 key genes used to train a Random Forest classification model for Major Depressive Disorder, achieving a test accuracy of 61.11% [Verma et al. DOI:10.007/s11571-021-09724-8]. In mice selectively bred for high or low methamphetamine consumption, RNA-seq analysis of brain reward circuitry identified the GABBR2 as a prefrontal cortex differential wiring gene and as part of a common cosplicing network for glutamatergic synapse genes, indicating its role in synaptic organization related to addiction risk [Hitzemann et al. DOI:10.3390/brainsci9070155].