Basic Information

Symbol
GABRA3
RNA class
mRNA
Alias
Gamma-Aminobutyric Acid Type A Receptor Subunit Alpha3 Gamma-Aminobutyric Acid (GABA) A Receptor, Alpha 3 Gamma-Aminobutyric Acid Receptor Subunit Alpha-3 GABA(A) Receptor Subunit Alpha-3 GABA(A) Receptor, Alpha 3 GABAAR Subunit Alpha-3 Gamma-Aminobutyric Acid Type A Receptor Alpha3 Subunit Gamma-Animobutyric Acid (GABA) A Receptor, Alpha 3 EPILX2
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_000808.4
Sequence length
3669.0 nt
GC content
0.4682

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1084.70 kcal/mol
Thermodynamic ensemble
Free energy: -1158.22 kcal/mol
Frequency: 0.0000
Diversity: 888.72
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((.(((........))).))...........((((....((((((((..(((((((((((((.((.(((((((((.(((....(((((.(((((((...)))))))............)))))......))).).))))))))))....((((........))))..))))))))...(((((((........(((....))).)))))))..(((.(((((.(((((..(((((((((.(((((.((....((...((((.((((.((.((...)))).)))))))).))...)).)))))))))))).))))))).))))))))...((((.(((........))).))))........)))))..(((((((((((..((((.........(((((((....(((.((((((...))))))))).(((((((((((....(((((((((((((((((((((.(((((((.(((((((...((.....)).))))))).)).(((((((((...)))))))))(((((((....).))))))..)))))....(((((..(.((.(((........))).)).)..)))))..........)))))..).))))))((.((((((((.(((((...)))))....((((((((...))).)))))....((((.((((...))))))))((((....(((((...((((((((((((.(((((.....((((........)))).......(((...(((((.(((((((.(((..((((....)))).))).))).(((....)))(((((..((((((...............)))..)))..))))).........)))).)))))...)))....)))))((((((((((((...((((((......))))))...)).....((((((.((((((..(((((((((((......))))(((((((((((...((((.....)))).................(((..(((((((((.((((((((.(((((.(((((((..........((((.........))))))))))..).))))).)).))))))))))...((((((.((((..(((..(((((.(((....)))..))))).)))..(((((.((((((((((.(((((...........(((.((((((.((((((((.(((((....))))).)))))).)))))))))))....)))))))))))))((((..................))))..(((((((((((((.(((((.(((((....((.((.((..((((((((((((.....(((((...(((...(((((.....(((.............))).......)))))....(((...(((......)))...)))...)))..)))))...))))))).))))).)))).))...))))).))))).))))))..))..))))).)).))))).....)))).))))))(((((...((((.((..............)).))))...)))))....)))))..)))......)))))))))))..(((.(((((......((((((...)))))).))))).)))..(((...(((((....((((....(((.((.....)).)))...(((((((((((..........))))))).)))).(((((((......(((.(((.......))))))...)))))))......((((...))))......))))......)))))...)))...((((((....))))))................................)))))))..)))))).))))))........................)))))))..)))..............))))))))))))....)))))..))))..((((..........)))).((((.((.((.((((.((..((((.(.(((((((......))))))).))))).)).)))))).))..))))....((((.........))))(((((.....))))).......)))))))).))((((((((.(((..(((.((((......))))))).((.((..(((..((((....((((...)))).......))))..)))..)).))((((.(((((((..........(((.....)))(((((..((..((((((((...((((....))))..)))).))))..))..))))).....))))))).)))).))))))))))).(((((.(((((((.((..((((((((((((((....((((......))))......))).............((((....))))........((((.(((((((....)).)))))..).)))..........)))))...........(((((.((((((.((((((((((......)))))))).......))))))))))))).........((((((((((...((((((((((...))))))))))....(((((.(((......)))..)))))((((.((((.....)))).........(((((.((.(((.(((((((((..(((...(((((..(((((((..(((....))).)))))..((((........))))...)).)))))...)))..)))))..)))).))))).)))))))))......((((........))))...(((((((((.((((...(((........((((((((....((.((.((((.(((((.......((((((..((.....))..))))))........(((((((((....((((((.....((((((...(((...(((((((...((((...))))...)))).)))))).))))))........)))))))))).)))))(((.....)))..))))).)))).)).))..(((((.(((.(((...)))...))).)))))......))))))))......)))...)))).))))))).)).(((((((((((.((((((.(((((((.((.........)).))..)))))))))))..)))).)))))))((((.(((.....))).........(.(((...))).).))))...)))))))))).((((((((((..(.....)..))))))))))....)))))))).))))))).)))))(((((...((........)).)))))........)))))))))....))))..((((((((......((((.......))))(((.(((((((.....(((((...)))))......))))))).))).))))))))............((((((((((((((((((.((....))((((..........))))((((((...(((((((((((..(((.(((............)))..)))...)))))))).)))...))))))....)))))))))).))))))))........)))))))(((((...)))))..(((((((.((((.(((((......))))).)))).))))))).....)))))))..)))))))).))))))).......))))))))...)))).
Thermodynamic Ensemble Prediction
..{(,(((........))).))....,,{{{{{({((,,,,(({(((((,.(((((((((({{{.,({(((((({({,((((,..(({({.(((((((...)))))))....,....,,.})))).,}},.))).},}))))))))).,..((((........))))..))))))))...(((((((........{{{....,}}.)))))))..(((.(((((.(((((..{((((((((.(((((.((.{{{{,...,{((,((((.(,{((...)))).))))))))}},,..)).)))))))))))).)}))))).))))))))..,{{{({((({,......}))},)))}{{{....,,))).,(((((((((({.,{(({{{{{,....{,((({,...,|||.{(((((...}))))}|||.(((((((((((....((((((((((((((({(((((.,,({,((.(((((((.{{(,...,}),.))))))).)},(((((((((...)))))))))(((((((....).)))))}..,||||,.,.(((((..{.((.{{{........}}}.}},}..})))}.,{,..,,}|)))))..}.})))))((.((((((((.(((((.{.|||||{{{{.,(((((({.{{||.,||}|....((((.((((...))))))))((((....(((((...((((((((((((.{{(((.....((((........)))).......{((...(((((.((((((({(((.,((({....)))).}}},}})}|||}}..,,,(((((..((((((...{....,,.....}}..})))..))))).........)))).)))))...)},....))))}({({((((({{{,..((((((......))))))...}}.....{(((((.((((((..((((((({(.{,,,..{{({{{((,.((((((({.((((,...,)))).......,.........|.|,..,{,.((((.((((((((.(((((,.((((((..........((((.,.....,.))))))))))..).))))).)),}))))))))).}}|((((...(((((((((((((({.,..(((((({{{{{..,.,.......})}))((((((({,(((((.....,,,...{{{.((((((.{{((((((.(((((....))))).)))))).}})))))),}}},,.)))))))))))))......,(((((((((.(((.{{{......(((({((((((.(((((.(((((....((.({,((..((((((((((((..{..((({{...{{(...(((((|,...{,..............,,,......,|}|||....{{{.,,|||......)))...)))...)))..)))))...))))))),,)))).)))).))...))))).))))).))))))......,{{{{.,,...|||,..||}..}||,}||{{{(((({.((((.((,..{,.........)},))}||..{||||{{,.....{{{{(,...........|||||{,..,{{{{.........||||||...))))}).,..}),,,..)}))}}}}}}||.....)))).)),))))))}}.))).)))))))))}))))))..},.})))))).)))))))....(((((((......(((.(((.......))))))...))))))).....}})))))))))).................}}}},}}}}....((((((....)))))).....................,,....,,,,,)))))))..)))))).)))))}...............,,.......))))))},.)))},.........,..))))))))))))....}))))..))))..{(({,{,....,.,}))}.,,||,,,.{|,|||..||..||{{,|.||{{,||..}}}},))))))}.,,,)},)})))).}.}).)))))....((((.........))))(((((.....))))).......)))))))).))((((((((.(((..(({{((((,....,))))))).((.((..(((..((((....((((...)))).......))))..)))..)).))((((.(((((((.....,,,,.{,,....,))){((((..((..((((((((...((((....))))..)))).))))..))..))))}.....))))))).)))).))))))))))).(((((.(((((((.(,.,((((((((((({.,....((((......))))....,|||,,,...........|({,....}}}}........((((.{(((({,....}}.))))}..},|}}.........,}))}),,,......{{((,,,,,,{{{|}|}{{((((((......)))))))}.,,......}}}}})}))}}..,,,....{{((((((((...((((((((({...})))))))))....(((((.(((......)))..))))){{((.((((.....))))....,}}..(((((.((.(((.(((((((((.,(((...(((((..({(((((..(((....))).)))))..((((........))))...}}.)))))...))).,)))))..)))).))))).))))))}}}......((((........))))..{({(((((((.((((...(((........((((((((,,{{({..{,||{,.,,,,,.......((((((..{{.....}}..))))))........{{{{|{{{{..|{{(((,,,{{,,(({{{{,,,({{...{{||||{...{{||,,,))}),,,))}},}.,))),}}}},,.,......,,},,{||{{{{{{{{((,.....,,,.}))))}.,,,))))}))}.(((((.{({.,{{...}}},..})).)))))......))))))))......)))...)))).))))))),),{(((((((((((.((((((.(((((,{.((.........)).})..)))))))))))..))))},))))))}|||,{({.....))},,.......{.{{{...))).}.}}},...)))))))))}.((((((((((..,.....}..))))))))))....)))))))},))))))).))))){{(((.{{(({{{.....,,.))),))}}...}})))))))))....))))..{((((((((({..,((((,,...,,||}},,..,((((,,....}|||,,...))))},.,,,.,,,)))}.))),}))))))}............((((((((((((((((((.((....}},(({,,......,.}}}|{(((((...(((((((((((..(((.(((............)))..)))...)))))))).)))...)))))}....)))))))))).)))))))).,,,....)))))))|{{||,..}}}},..(((((((.{(((.(((((......))))).)))).))))))).......)))))..}))))))).))))))).......},))))))}..}}}}.

Transcripts

ID Sequence Length GC content
GAGCGCGCGCAAGCUAGCGAGCAAACCAGAGAGACAGACCGAGAGAGGG… 3669 nt 0.4682
Summary

GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the GABRA3 mRNA showed no significant change in expression in the hippocampal dentate gyrus, orbitofrontal cortex, or dorsolateral prefrontal cortex of individuals with alcohol dependence compared to controls [Jin et al. DOI:10.3389/Fncel.2011.00030]. In a separate review, the GABRA3 was identified as a primary network contributor in the human prefrontal cortex associated with lifetime alcohol consumption [Warden et al. DOI:10.1016/J.Neuropharm.2017.02.017].