Basic Information

Symbol
GABRA6
RNA class
mRNA
Alias
Gamma-Aminobutyric Acid Type A Receptor Subunit Alpha6 Gamma-Aminobutyric Acid (GABA) A Receptor, Alpha 6 Gamma-Aminobutyric Acid Receptor Subunit Alpha-6 GABA(A) Receptor Subunit Alpha-6 GABA(A) Receptor, Alpha 6 GABAAR Subunit Alpha-6 Gamma-Aminobutyric Acid Type A Receptor Alpha6 Subunit GABA Subunit A Receptor Alpha 6
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_000811.3
Sequence length
2450.0 nt
GC content
0.4049

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-644.40 kcal/mol
Thermodynamic ensemble
Free energy: -689.13 kcal/mol
Frequency: 0.0000
Diversity: 671.71
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((.((((..(...((((((..(((((........(((((...........((((((((.........)).))))))(((((.((..(((..((((((.......)))))).)))..)))))))...((((((..........((((((...((((((.((((((..(((.(((...(((....))))))(((.(.(((((((....(((((.(...(((((((((((((((((...)))))......(((((....)))))..((((((((....)))).))))...(((((((.((((.((((((((.((......((....))......(((((((....)))))))............(((((((((((((((((..........(((((((..((((.(((((...(((((((.(((((((.((..((((((((((((......))).)))).))))))).))))))))))).))).((((.((..((((.(((((.(((((.........(((.((((((.(.((((.......)))).).)))))).)))(((.(((..((((((((((((((.((..((..((((((......)))...)))...))..)).))))))(((((........)))))..............................))))))))....)))..)))..))))).))))).))))....))...))))...))))).))))(((((....(((((.(((((.....((((((((((((((..(((........))))))).))))))))))..)))))..)))))......)))))......((((...(((((...))))).))))..((((...)))).))))))))))))...))))))))).)))(((((((.....((((((........)))..))).(((((.....((.(((.(((((((........(((((...((..((((((((.(((..(((..((((...(((((.........((((...)))).........)))))...))))..)))..))).)))))))))).)))))))))))).))).))))))))))))))....((((((.(((((..(((..(((((...)))))...)))..))))))))))).....)))))))))).)))).)))))))...(((...)))..))))))))))))......).)))))....)))))))).)))...((..((((((((.......((.....((((..(((((((((.((((.(((....(((((.(..........).)))))......)))..)))))))))))...)).))))....))........))))))))...)).)))..))))))))))))......))))))..........))))))..((((((....))))))...))))).........))))).))))))...)..)))).))(((((((((((((...(((((.((((......))))...((((((...(((..((((((...((...(((((((.((((.((((((...(((((((((....)))))).))).....)))))))))).))))))).)).))))))..)))......))))))......(((((((((((((((((..(((((............))))).))).((((((((((((.((..(((.(((((.........(((((..((((...)))).)))))....)))))(((((...............)))))...........((.((((((((((.((((((....(((..(((((((.....))))))).........((((((((((((((((((...))))))))).....))))))))))))..)))))))))))))))).)).)))..))...)))))).)))))))))))..))))))))).)))))...)))))))))))))........(((((((((((((..(((......(((((((((....(((((((.........)))))))((((((((((((((.((((((..((...))..)))))).)))(((((((((((((((((........)))...))))))...))))))))....))))))).)))))))))))))((((((......(((((((..(((((((((((....(((((((((........))))))))).)))))).........((((.(((.((((((.......))))))))).))))..................)))))..)))))))......)))))).(((........)))(((((((((((...)))))))....)))).(((((((......((((.....)))).....)))))))........)))..))).))))))))))
Thermodynamic Ensemble Prediction
.{{.((((..(...((((((..(((((........{((({...........((((((((.........))}}}))))((((,,((..(((,,(({{{{,,,....}}}}}}.)))..)))))))...{,((((,.....(({{{{,((({,.{{{((,,((((((..(({.,{({{{({{,{{{{.....(((.(.(((((((....(((((.(...(((((((((((((((((,,,,|}||...,,,(((({...,|||||,.((((({{(,,,.}}}).))))}||{{|,||||||{,.{{{||{||.||,..,}.}}}}}}))....{{{{((({(,,{.}},)))).,}}..},....{((((((((((((((((......,,,,(((((({.,{{...,((((....)))){({(((,,.({.(((,(((((((,(((......))).,,},.}|||{(((({{((((,,{{.(((((,{(((({{((((.(((((.(((((.........{((.((((((.(.((((.......)))).).)))))).))}(((.(((..((((((({((((((..,..,{..((((((......))},..}}),..},..,,.)))))}(((((........))))|,.{{,.....}}}.................})))))))....)))..)))..))))).))))).))))....},..)))},..,,)))))}),)}}|,|}}}}}||||,,|{(({{...(((((((((((((|.|(((........})))))).)))))))))).,}}}}}},,,.}}......,||||......,,,}}})|||,,}}})).}}}))}))....},,)))))))))}))})))))...))))))))))},|(((((((...,.(((({{,.......,,,.,||,.(((((...,,{,.,,{.(((((((........(((((...((..((((((({.(((..(((,.((((...(((((.........((({...)))).........))))).,.)))).,)))..))).}))))))))).)))))))))))).})),},))))),})))),....((((({,(((((,.(((..(((((...)))))...))),.))))))))))).,,,,,.}}}}}})}.))}},)})})))}},|||...},,.}))))))))))))......).)))))....)))))))).))).....,}||||||||}......,(,,...{{{{.,||(((((((.((((.(((....(((((.{..........}.)))))......)))..))))))))))}..,}}.}}}}....}|........}|}},}},...)),)))..))))))))))))}}...})))}}}...)}}}},,},,,},..((((((....))))))...))))).........))))).))))))...}..)))).|}(((((((((((((...(((({..,,{,.....,,,,...((((((...(((..((((((...((...(((((((.((((.{(((((.,.(({((((((....)))))).}))...,.)))))})))).))))))).)).))))))..}|}...,..)}}}))......{((((((({((((({({,.{(({{.,........,.})}}},)}}}(((((({(((((,{{..(({.{{{{{,........{({{{..{(({.,,||||,|}}}}.,}}),)))||{{|,......,|,.,...}}}}},..,,......{{.{((({{{{{||{{{{{{....,,{..{((((({|....))})))),,...,,,,{{(({(((((((((((({.,.}))))}}},,,..})))))))))})),,)))))))))))))))).}}.}}},.,,...})))))},))))))))))..})))))))).)))))...)))))))))))))........{((((((((((((..{{{,,...,{((((((({....(((((({.........))))))}((((((((((((((.((((((..((...))..)))))).)))(((((((((((((((((........)))..,))))))...))))))))....))))))).))))})))))))}((((((.,,.{.(((((((..(((((((((((....(((((((((........))))))))).))))))}.,.,,.,,((((.(((.((((((.......))))))))).)))}..................)))))..))))))}.}}.,,)))))).{,|||.....{||,{{{{(((((((...)))))))....}))).}}|||}}.,,,..{(((,....)))}.....,,,,,,}..,,....,,}..))}.)))))))))}

Transcripts

ID Sequence Length GC content
AGUCAGAGGAGCCUGGGUGUCUGCAGGACAUAAUCUAAGACCACAAACC… 2450 nt 0.4049
Summary

GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the GABRA6 is linked to alcohol dependence and stress response, as it was altered in a unique gene expression cluster in the nucleus of the solitary tract of dependent mice exposed to both chronic intermittent ethanol and forced swim stress, implicating its role in stress-induced escalations in drinking [Grantham et al. DOI:10.1016/J.Neuropharm.2023.109768]. In human postmortem brain studies, evidence also associates the GABRA6 with alcohol dependence, as indicated by meta-analyses [Warden & Mayfield DOI:10.1016/J.Neuropharm.2017.02.017].