Basic Information

Symbol
GABRD
RNA class
mRNA
Alias
Gamma-Aminobutyric Acid Type A Receptor Subunit Delta GABAARdelta Gamma-Aminobutyric Acid (GABA) A Receptor, Delta Gamma-Aminobutyric Acid Receptor Subunit Delta GABA(A) Receptor Subunit Delta GABA(A) Receptor, Delta GABAAR Subunit Delta Gamma-Aminobutyric Acid Type A Receptor Delta Subunit GABA-A Receptor, Delta Polypeptide GEFSP5 EIG10 EJM7
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_000815.5
Sequence length
1914.0 nt
GC content
0.6358

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-838.70 kcal/mol
Thermodynamic ensemble
Free energy: -873.27 kcal/mol
Frequency: 0.0000
Diversity: 393.93
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((((.((((.(((.((((.((((..(((((.((((..((..(((((..(.((((..((....))..))))....)..)))))..))..)))).)))))...((((((.(((((((((.....)))).((((((.........(((((.....))))).......))))))(((((...))))).(((((((.(((((((...)))...(((((.....)))))..((((.((....((((((((.....((((.((((((((.(.(((((((.((.(((..(((((((((((((...(((((.........((((.((.(((.((.(((.((((.((((((...((((((.((((..((.((.(((.((((.(((................(((((...)))))))).))))))))).))....)))).))).)))..)))))).)))).))).)).))).)).))))))))).(((...)))(((((((((.....(((..((.(((....))).)).)))(((((.(.(........).).))))))))))))))((((((.(((...(((((((((........(((((((.((((((((((((.(((((.(((((.((((((((((..(((....)))...)))))........((((((..((((.(((.....)))...))))((..((((.(.((((((.(.(........)).)))))).).))))..)).((((..(((......)))..)))))))))))))))))).)).))))).)))))).......(((((((.......(((((((.............)))))))))))))))))))).))..))))).(((((.(.(((....)))..).))))).((((.(((((((((((((.......((((.(((...(((((((((.((((......)))).))))))))).((........))....(((....)))...((((((..(.(.(((((....))))).).)..)))))).)))..)))))))))))))).)))))))((((((..((((.............))))..)))))).)))).)))))...)))..))))))...((((((((.(((...(((((.(......))))))...))).)))))))).((.(((...))).)).)))))))))))))....))))).))))))).))))))........)))))))..)))))))))).)))))))).)))))))........))))).))).))))))).)))).))))))).)))).((((((.((((((((..((((((((((((((......(((((((.(((.(((((((((.......)))))....)))).))).)))))))....(((((((((...((((..((..((.((((((..((((.......))))))))))))))..))))...))))))))).........(((.(((.(((((....)))).).))))))))))))....))))..)))).)))..))))).)))))).......(((((.((.((((.(((((((((((.((((((.((((.........(((((((((.(((((..((....)).))))).....((((.(........).)))).(((....)))...)))))).))))))).)))))).))))...))))))))))).)).)))))((((((......((((((((((((.(((((....)).)))..)))))))))))))))))))))))((((.(((((((((((.((.(((((......((.(((((...(((..((.((....)).))..))).........))))).))))))))).)).))))))))))))).
Thermodynamic Ensemble Prediction
..(((((((((.((((.(((.((((.((((..(((((,((({..{{..({((({.{.,((({{,{.{{,,|..}}))}...)},)),)},})),,)))}{||}}|(((.(((((,(({({((({{,{,.||.}},{{{|{,,..,.,.,(((((.....))))).|.....)))))|(((({...})))).{(((({{,((((((....|||.(,((({,..}}}),}}},||||{|{,.,..((((((((.....((({{((((((((.(.(((((((.{{{(((,.(((((((((((((.,,{({(,........{((((.((.(((.((.(((.((((.((((((...((((((.((((,.((.((.(((.((((.(((................(((((...)))))))).))))))))).))..,.)))).))).)))..)))))).)))).))).)).))).)).)))))})}}.,.,,.{|||(((((((((.....(({,.{{.|||,...|||.}}.)))(((((,,{({...,}}...).)))))))))))}}}((((((.(((...(((((((((........(((((((.((((((((((((.(((((.(((((.((({,{((((..(((....)))...}}))),....,{(((((((..{(((.(((.....)))...)))}((..{(((,(.{(((((.{.,|,....,.||.}|||||.|,|}}}..}}.||||,,||{,,....))}..)))))))))))))))))).)).))))).)))))).......(((({{,..,,,,((((((((.............))))))))}}}}}))))))).)),.})))).(((((.{.(((....)))..,.))))).((({{((((((((((((({......((((,{.....|||||((((.((((......)))).))))}||||,({.....,..},..,)))|},.||}{{{.((((((..(.(.(((((....))))).).)..)))))).)))..))}))))))))))).)))))))((((((..((((.............))))..)))))).)))),,))))...)))..))))))|..((((((((.(((...(((({,(,....,))))))...))).)))))))).,},|||}},))}.)),))))))))))))).,..))))).)))))))},)))))........)))))))..))))))))})})))))))).)))))))}.,...,.)))))})))},)})))).)))).))))))).)))).((((((.(((((({{..((((((((((((((......(((((((.(((,((((((((({.....,)))))},..)})).))).)))))))....(((((((((...((((..(.,.((.((((((.,((((.......)))))))))))),)..))))...))))))))).........(((.(({.{((((....)))).}.)))))))))))),...}))}..)))).)},.}))))).)))))).......{((({.((.((({,(((((((((((.((((((.((((.........(((((((((.((({(,{({,,,.}}.})))},}},|(({(.,.......,|.}}}}.|||}},..}}...)))))).))))))).)))))).))))...))))))))))).)).))))){(((((......((((((((((((.{{((,....,,.))}..)))))))))))))))))})))))((((.(((((((((((.((.{((((......((.(((((.{{(((..((.((....)).))..})).........))))).))))))))).)).))))))))))))).

Transcripts

ID Sequence Length GC content
AGCUCCCGCCCGCCUGUGCCGCCUGUGCGGCCGCCGGGAGCCAAGUUUG… 1914 nt 0.6358
Summary

Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. The GABA-A receptor is generally pentameric and there are five types of subunits: alpha, beta, gamma, delta, and rho. This gene encodes the delta subunit. Mutations in this gene have been associated with susceptibility to generalized epilepsy with febrile seizures, type 5. Alternatively spliced transcript variants have been described for this gene, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice selectively bred for high or low methamphetamine intake identified the GABRD as a differentially wired gene in the prefrontal cortex, indicating its involvement in the transcriptomic networks associated with innate risk for addiction [Hitzemann et al. DOI:10.3390/brainsci9070155].