Basic Information

Symbol
GABRE
RNA class
mRNA
Alias
Gamma-Aminobutyric Acid Type A Receptor Subunit Epsilon Gamma-Aminobutyric Acid (GABA) A Receptor, Epsilon Gamma-Aminobutyric Acid Receptor Subunit Epsilon GABA(A) Receptor Subunit Epsilon GABA(A) Receptor, Epsilon GABAAR Subunit Epsilon Gamma-Aminobutyric Acid Type A Receptor Epsilon Subunit
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_004961.4
Sequence length
3149.0 nt
GC content
0.5008

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-967.10 kcal/mol
Thermodynamic ensemble
Free energy: -1026.72 kcal/mol
Frequency: 0.0000
Diversity: 822.34
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((..(.(((((((.((.....)).))))))).)((((...((((((........((.(((((((((((((.(((.((((......(((((((((.....)))))))))(((.((..((((...((((......((((...))))...))))...))))..))))).........))))..)))........(((((...))))).....((((......))))..)))))))))..(((..(((((...((((((.(((((((((((..((((.........((((..(((((((((.......(((((((((((((((((((.(.(((....((...(((((((........))))))))).))).).))))))))(((.......)))......((.((...(((((((....((((...(((.........))))))).....((((((((((...(((.(((((.......((((...((((((.((((((.(((.(((((((..(((.....)))...)))..).))).)))..))).)).).)))))))))).....(((((.....)))))))))))))...))))))))))........))))))).)).))))))))).((((((((((.....((((((((((...((((((((((((..((.....((((((((((................))))..)))))).....))))))))))...)))).....))))))..))))........((((((....))))))............))))))))))....(((((...............)))))))))......)))))))))..))))..))))))))))).))))..))))))....))))).)))..)))).)).......))))))))))...)))))))..(((((((((((.(((.(((.(((((((..((.(((.....(((....)))..))).)).))))))).)))))).(((.((((.(((......((((....))))...))))))))))........((((((...(((((((.(((..((((...((..........))...)).))..))).))))))))))))).....(((((((((..............((((....))))............((((..((((..........(((((..(((........))))))))....))))..)).))........))))))))).(((((.((.((((...((((((((((.(((((((.((((((((((((((..((.(((((((...((((((...((.(((...((.(((...((((.(......).)))).)))))..))))).))))))))))))).))..))))))......((((((..(((((((........((((((((((.((.(((..((((((....))))))..))).))))(((.(((((..((((....(((((..(((........))).................((((((((.(((......)))..........((((((....))))))..))))))))..))))).))))..))))).)))....).)))))))..((((((((((((((.((..(((((((..(((((((.(((....))).)))))))..((..(((....(((....)))....)))..))...)))))))..)).)))))....(((((((((..(((((....)))))..((.....))............))))))))).................(((((((...))))))).(((........)))...(((...)))..)))))))))...)))))))..)))))).((.((.(((((..............))))))).)).......((((((.........(((((..(((((.......))))))))))..(((((((((((((....))).......(((.(.....).))).((((.......))))........))).))))))).))))))..(((((((((.(((....)))))))..(((((((.....((((...(((((((.(((..((((.............))))..))).))).)))))))).........((((((((((((((.(((((((((((......((..((((((...............))))))..)).....)))).))))))).)))).......(((.((((..........((((((..........))))))..........))))))).................((.......))..))))))))))....))))))))))))....)))))))).))))))))))).......(((((.((((...))))..)))))....))))))...)))).)))))))....)))))))))))(((((((....(((.......)))........((((((.....))))))..(((((((((((((.........((.(((((((((..........)))))...........))))))......((((.((((........................))))))))...)))))))))))))((((.((...((((.....)))).....)).)))).......((((((.........))))))..........(((((((((..(((((((.....(((((((((((....))))).(((.((((..(((..((((.....)))).))).)))).)))....(((((.((........)).)))))..))))))................((((.((((((.(((((....)))))....((((((((((((((............)).))..))))))))))))))))..))))......(((((.(((....(((.((((.(......).)))).))).))).))))).(((.((((((((....((((.((..((......))..)).))))...)))))))).)))((((((((((.....))))))......))))....)))))))))))))))).((((((......))))))..))))))).
Thermodynamic Ensemble Prediction
{(((((({.(,(((((((.((.....)).))))))),,(({|..,((((((.....{..((.(({{(((((((((,{{..{((,..,...,((((,,(((((..|.((((,{.(((.((..((((...((((..{,..((,,..,)))}...))))...))))..))})),}.))))..|,..)))))..}}}},.(((((...))))).....((((......))))}|))))))))},,(((.,(((({.,.((((((.(((((((((((..{(({.,..,,...((((..(((((((((......,(((((((((({((((((((.(.{{(.,,.((,..(((((((........))))))))).})),},))))))||{{{{|,..((((......)))},|...,,,,{{{,,.,{{|,..|||{,,{{.{..,||||,|||....((((((((((...(((.(((((..,,...(((,..,((((((.((((((.(((.(((((((..(((.....)))...))}..).))).)))..))).)).).))))))))))....,|((((.....))))}))))))))...)))))))))).......,)))})}.....})})))))).((((((((((.....((((((((((,..{{({((((((((..{(...,,,(((((((((.{{........,..,,)))),.}))))),....},))))))))...)))}....,)))))}..}}}|.,,,.,,,((((({....))))))..,},,,,,...))))))))))....{((((...............))))))))).,.,..))))))))).,}}}}..}))}})))))).))))..))))))....))))).}}}..}})}.}}.......})))))))))...))))))}..{((((((((({.(((.(((.(((((((..{(.{{{..,{,{({....}}}.}))}.}}.))))))).)))))).((,{((({,(((......(({{....))))...))))))))))........((((((...(((((((.{({..(({{...((..........))...}),)}..))}.))))))})))))).....(((((((((.,......,|,...((((....))))............{{{{..{{{{........|.{((((..,,{...,....,),))))),...))))..}).))..,.....))))))))).{((((.((.((((...((((((((((.(((((((.{(((((({{{{({{.,(,,{(((({,{{(((((({....,.(({,,,((,(((,{.{{||,|...,{{|{|}}}.|||,,.,))})).})))))}).||||.|||||||,,.......((((({..(((((({....,..,|||{|||,,{..,,|{|||({{(({,.,,)})))),,}}}.}}}}{{{.{{{((,.{{{,..,.((((({{({,.,{{{{|,||,,,,.............,{{{,.,{{,(((..,..,|||,........,((((((....)))))),,}}))))))),}}}}).))),..}}}}),))},,{{|||||||||..|((({(((((((((.{(,.(({{{{|,.(((((((.(((....))).)))))))..{,..{||,...{{{,.,.|}),,|,))}..}),,.}}))))),.}}.}}}}}....(((((((((..(((((....)))))..{{.....,,............))))))))).......,,.....,}}(((((((...))))))).(((........))),,,,{{,,,|||,.}}}}}}}}}...}))))))..)))))).((,((.({(({..............))))))).)).........(((,.......}}}{{({..((((.((((((((.((.(((...((((.......))))..)))))))))).))).....}})}.)))|||{....,,,))},..},....,}.}))))))),)))}},..{{{((((({{(((....)))))))..(((((((.....{(({...(((((((.(((..((((.............))))..))).))).)))))})}.,,......{(((((((((((((.(((((((((((......((..((((((.............,.))))))..)).....))))}})))))).)))).......(((.((((.,,.{{....((((((..........))))))........)})))))))...{{,...........|{.......}}..))))))))))....}))))))}}}))}.}})))))))).))))))))))),......(((((.((((...))))..)))))...,))))))...)))).)))))))....})))))))))}(((((((....(((.......)))...{{,.{((((((.....)))))).,,|||(((((((((,,,...,,,{|.{((((((,,..,,,,..{{|,,,,}}}}}}}..},)))),.......,,,,.,{{{.........{{{{{,......,}}))),}))),,,})))}}}}}))}|{|||,,,,}}|{||,,,,,)))),)),,))})}}},..|,,.((((({.,....,..)))))),,,,,,,,..(((((((((..(((((((.....(((((((((((....))))),(((.((((..(((..((((.....)))).))).)))).))).,..(((((.((........)),)))))..)))))).,,....,||......((((.((((((,(((((....)))))}...((((((((((((((............)).)}..))))))))))))))))..))))..,...(((((.(((..,,({{.((((.,,,....}.)))).))).))).))))).{{{.((((((({....((((.((..((......))..)).))))...,))))))),|||{{,{(((((((....,},)))}}},..,})),,,.)))))))))))))))).((((((......))))))..))))))).

Transcripts

ID Sequence Length GC content
AGAGCGUGAGCCGCGACCUCCGCGCAGGUGGUCGCGCCGGUCUCCGCGG… 3149 nt 0.5008
Summary

The product of this gene belongs to the ligand-gated ionic channel (TC 1.A.9) family. It encodes the gamma-aminobutyric acid (GABA) A receptor which is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes an epsilon subunit. It is mapped to chromosome Xq28 in a cluster comprised of genes encoding alpha 3, beta 4 and theta subunits of the same receptor. Alternatively spliced transcript variants have been identified, but only one is thought to encode a protein. [provided by RefSeq, Oct 2008]

Forensic Context

A study in human post-mortem brain samples demonstrated that the GABRE mRNA showed no significant change in expression in the hippocampal dentate gyrus, orbitofrontal cortex, or dorsolateral prefrontal cortex of individuals with chronic alcohol dependence compared to controls [Jin et al. DOI:10.3389/Fncel.2011.00030].