Basic Information

Symbol
GABRG1
RNA class
mRNA
Alias
Gamma-Aminobutyric Acid Type A Receptor Subunit Gamma1 Gamma-Aminobutyric Acid (GABA) A Receptor, Gamma 1 Gamma-Aminobutyric Acid Receptor Subunit Gamma-1 GABA(A) Receptor Subunit Gamma-1 GABA(A) Receptor, Gamma GABAAR Subunit Gamma-1 Gamma-Aminobutyric Acid Type A Receptor Gamma1 Subunit Gamma-1 Polypeptide
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_173536.4
Sequence length
6758.0 nt
GC content
0.3286

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1538.50 kcal/mol
Thermodynamic ensemble
Free energy: -1678.82 kcal/mol
Frequency: 0.0000
Diversity: 1863.58
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((.(((...((((((((((((((((.((((((((((((.((((..((((...((((((((.(((((....)))).).))))((((....))))((..(((((((..(((((.(((.....))).....((((.(((((....)))))))))...))))))))))))..))(((((((((((((.........))))))))).))))..((((...........)))).))))...))))....)))).)).))))))).......(((((((.((((((...((((((.(((((((.((((.((((...((((((((.(((((..(((............)))...))))).((((((...(((((((..........))).....))))...))))))(((...((((((.(((((..((((((((.....))).))))))))))....))))))...)))................)))))))).)))))))))))))((.(((.(((...(((((((....((((((..(.((.(((....))))).)..)))))).........)))))))...)))))).)).(((((............))))))).))))))...))....)))).)))))))..((((((...(((((..(((((((((((((((.((((((............((((((((((((.((((((((.............((((((.((((.(((((........))))).))))..))))))((((.(.............).))))....(((...((((((.......)).))))..)))......)))))))).))))...))))))))..))))))))))))))))...(((......)))...((((.((.(((((((((((.(((.((..(((((((((....(.((((((((((((((.........((((((((...................(((....))).((((((((((((((((.((.(((......))).))(((((((((((........(((((((((((((((((((..((((..((((((((.(((....))))))).((((...((.((((....)))).))))))((.(((..((((..((((((((((.(((...(((((((((((((((((((..(((....(((.................)))....)))..)))).....))))....))))))))))).............((((..((.(.((((.((((((....((((..((...))..))))..(((......)))((((.(((((((..(((......((((.((((.((((.....)))).)))))))).(((((((.(((((((((((((......(((((((.....((.((...(((((((((.......((...))..........(((......))).)))))))))...)).)).....))))))).....(((((..(((((...........)))))..)))))..))))).))))))....)).))))))).........(((.((((((((((((((((((.((((.(((((((..............(((....((((...))))....)))(((((((......)))))))......))))..((((((((((((..((((((.((((................))))..)))))).........(((((.((((((......)))))).)))))......)))).))))))))((((((.((((.((((....(((((((((...((((...)))).))))))))).....)))).)))))))))).((((((.(((.((((((...((((((((...(((.((...(((((.(((((...((((........((((((((((((((((.(.........).))))))))...((((((.(((.((((((..((((.((((((((((.....))))...((((....))))(((((((......)))))))...))))))..)))).((.(((((((.............))))))).))...(((((......)))))..(((((((((((.......(((((((((((((..((((((.((((..(((((((.(((((((((.((((....))))..)))))..))))(((((.........))))).....(((.(((..(((......)))..)))...))).(((((((.((((...(((((((.(((((...)))))...)))))))...................((((((..((((......)))).......)))))).....(((.((((((((((((....((((.(((((((((..(((((.(((..((((....)))).)))...)))))...((((((((((((((((..............(((((((......))))))).((((((.((((.....)))).))))))......((((((((...(((((...((((((((((((....(((..(((((.((.(.(.((((....((((((....(((((....)))))....((((((((((((((...((((((......)))))).((((...........))))...(((((((..((((...(((((((....((((((((((....))))).)))))....)))))))...)))))))))))...((((((((((.......((((((((((.((((......))))))))....))))))....))))))))))....(((((((.......(((((....)))))..)))))))....(((...((((((..((....))..))))))...))).(((((....))))).....((((((((.((....)).)))))))))))).))))))...))))......))))))...))))).).)))))))....)))...(((..((.(((...))).)))))))))))..)))))))))))....)))))))).......))))))))...))))))))..((((.((...(((((((((.((((.(((((...((((..((((....))))..))))))))).)))).))).))))))...))))))................)))))..))))))))....)))))))))))).))))))).)))))))....((((((((((.((...(((((((((((((((((((..((((((......))))))..........(((((((.((((.(((((((..(((((............)))))....))))))).)))).)))))))..)))))))))))).............)))))))................((((.((.....((((((((((((.(((((((...(((((....)))).)...))))))).((((((......))))))((((((..((((((.((((((....(((((....)))))......))))))))))))....(((.(((.((((((.(((((((.((.((((((.....(((((((((((((......((..(((((((..(((((............)))))..((((((((((((.........))))))))))))..(((((....)))))((((..........)))).))))))).))...)))))))......))))))......)))))).)))))))).).)))))).))).)))......(((((.((((((.((....)).)))))).)))))........((((((((((((((((...(((((((((..(((((((.....)))))))((((.((((.(((((((((((((((((((((((((.............((((((((....))))))))(((((((((((((((((((((.(((((..((((....))))..))))).))))).((((...((((.((((.(((((....((((((...((((..............))))...))))))....))))).)).)).))))..)))).....(((((.(((((....(((((((...(((......)))....)))))))...)))))))))).........)))))))))).....))))))((((((((......(((((((........))))))).........((((((((((((((....)))))......))))))....))).)))))))).........(((.....))).....))))))).)))..))).))))))))))))....((((((.(..(((.........)))...).))))))...(((((((((((((((((((..........((((((((......))))))))(((((((((....((((...(((((..(((.(((((.....))))).)))...)))))...)))))))))))))........))))))))).........)))))).))))..........((((((.....))))))...))))..)))).....((((.......)))).(((.((((...........)))).)))..........(((((.....(((......))).....)))))....................((((((.......))))))....)))))))))...))))))))).))))))).(((((.((((((((((((((((........(((((((((......(((...)))......))))))).))........))))).(((((((.(((((((..(((((((....(((((........)))))))))))).)))...(((((...))))).))))..)))))))((((.(((((((....((......))...))))))).)))).)))).))))))).))))).((((((((.((((((((..((((..((((((..........((((........))))......))))))..))))...))))))))......((((((..((((((.((((((.((........))..((((((((((...(((..........(((.....)))..........))).....))))))))))....(((((.............(((((((((((.......))))))..))))))))))..(((((((((((((.........(((((((...)))))))...........((((.(((((........))))).))))..)))))))))))))....))))))))))))..))))))((((...)))).))))))))..))))))...))))))))))))...)))))))).)))))...)))))...)))))))....))))))))))..)))))).)).)))))......)))))))))))(((((..(....)..)))))....)))))).)))..))))))......(((....))))))))))).........))))...))))).)))))...)))))...))))))))...)))))).))).))))))...(((....))).....(((((((((...(.((((..(........)..)))).)...)))))))))))).)))).)))))))))))))..............))))).)))((((((((((......((.((((((((((........))))))).))).))((((.((((......)))).)))).)))))))))).)))..))))))).))))..........)))))).)))).).))))))........((((...((((.....))))...))))))).)))))).)))).....))))..))).))..)))).))))..))))..))))))).)))))))))))))........))))))))))))))).)))))))..))))))))...........))))))))).))))).)((((((((((........)))))))))))))))))))..)))))))))).))))))..)).)))).))))).))))).....))))))...))).)))).))))...((((((((((((...........(((((((....))))).))........((.(((((((((((......))))))))))).))........)))).)))))))))))))))).....((((((.....))))))....(((.(((((((.....((((((((((((((((.((....(((((((......)))))))..)))))))))......(((((((((..(((((((.((....)).)).))))).........((((((............)))))).(((.......))).....(((((((....((((...((((.((.....)))))).))))))))))).......((((.(((((.(((....)))....))))))))).((((((((((....(((((.......)))))....)))))))))).(((....((......))....)))))))))))))))))))))....))))))).))).....))).))).((((((...((((((....((....)).....))))))..)))))).....................(((((.......)))))...
Thermodynamic Ensemble Prediction
{{,,.(((.(((.((,....)),)))))).(((((((((.((((..((((...({{,((((,(((({..,,)))),).}})|{((({,,{|.||{{{{,({{{,,.,,||||,|{{,....,,,,,...((((.(((((....)))))))))...,)))}}}},||||,||{(({|,(((|{({...},,.}}),})))))).))}}..{{{{..,.....,,,)))),))))...))))....)))).)).)))))))....,{{.(((.(((((({{{{{{{(((.......)))(((((((({{{,{.....,{{{(,((({.,,............,)))}},}{(((.(((....))).}))}.......||||||,,.......)),,))))))}},.,.,.,,,,.,{(((.,((({{{{{.....)))}}))}}))))),.(((((((((((((((((...,.........,(((((((((({{(((((......)))..}}}}..........{((((.......}|}}|,.{(({{,.,,{,..((({(((((((.....,,(((.((((((...((((({((..{{{,{{{{{,.,,{((((((({..(((,{(({{{(((((.((.(((((((((({.(((..(((((({,,((((((((((.{(((((.,,..,,{{...,{{{{{{{,|||,|{||{{{{.............((((((.((((.(((((........))))).))))..)))))),,((,(,,..,,,,,,,{{|,||||....(((...(((((({....}.}).))))..)))......)))))}}).))))}},)))}))))}.))))))))))))))))....,.,{{{.,{|{...,,,,,.}}}))))}.,})))))))..))}.,,...,}},...})))))).)).})))|...........{{(((....{{,...}}}...))))}.|)}})}}.}}}},))))}|||{{{{{(.,,{...,,,))}{|||,..))),)||||....}}}}}}.}}}.......))))))))}}),,..,,,})))}},...,|{|||||,(((.{{((.((((....)))).))))..,|((,((,...{{{{{(({,|,{{{{{....{((((((((((((((((((..(((....(((.................)))....)))..)))).....))))....)))))))))))}|..,.}))))))))}}}),.)))))})))),{{{|...,)))|{{{,.{{{{||||||{{{.,.,|.{{{|{,,...},,))))))),,))))})).))))).)},}))}))))))))))|(((((((...((((((({.((((.,,,.,,({.(((((((.....((.((,..(((((((((.......,{,..|,,.....}}..{{{......})}.}))))))))...)).}}...,.)))))))......(((((((.((((((..{(((((.(({.....{{((..((((((((.......(((((((..{(((({,....,,))}}}}.)))))))..(((((((((({{((((((((((..((({..{((,,,,(({{...|||},...|||(((((((......))))))}...{({.,,...((((((((((({..((((((.((((..........,,....))))..)))))).........{((((.{(((({......)))))).)))}}...,,,)))),,)))))}}.((((((((((.,,,.,({.{{((((((({...,{{{{{||,{{{|||,,,{{{{{{{{||{.||,.,,{||{{{,,,,,})}}}}....||,||}||||}}||,,,.}}}}}}..,}}||.,,,,.}}}}}|}|{{{,..,|||((.(((((({{,(,........,,)))))))).))..,,,,..,}}}},....}}}))))),.)))..,..)))))))))),}}},{{{{{..(((((((......))))))).}}))).,,..,|,,,,,...},}.})))..)))))))).))))))))))))).)))))))).}))}...{((((((((((.......((((((((({(((((((((({{((((..(((((((.(((((((((.((((....))))..)))}},}||}|,{{{{.,,.....,}|||||,...|||.|||..(((......))).,||,...},}.{{{((({.{{(({{{(({{{{{.(((((...,}|||||,}||||||...................{{((({.,{|||......)))}..,,...))))))||,,,(({.,(((((((((((....({{{{(((({((((..(((((.(((..((((....}))).)))...}})))..{((((((((((((((((.....,,,,,..,,({(((((......))))))).((((((,((({.....)))).}))))),{{,..,||||{{{...{{(({{{{((((({((((({....{{{..(((({,((.(.,.((((..{,{(((((,.,.(((({....)))))..,,((((((((((((((...((((((......))))))..........,{{(((((((,.,((((({(,,((((...(((((((...,(((({(((((....))))).)))))....)))))))...))))})))))),..((((((((((.......{{{{{(((((.((((......))))})))}...,}}}}}....))))))))))....{((((((.....,.{{{{{....})}}},.))))))}.....,,..,|{{{{{,.{{,...}}..}}}}})}}})))}|||{{..,,|||},.,},,|(((((((.((....)).)))))))}))))},)))))...)))}...,..))))))}..))))}.).)))))))....}}}..{(({.{((.(((...))).))}}}))))))..)))))))})))}},.)))}))}),,,},..))))))))...}))))))}.,{{(|.{{,..((((({(((.((((.(((((...((((..((({....})))..))))))))).)))).))),)))))),,,)))}}}................))))}..))))))))....)))))))))))}.))},,}},}}}))))....((((((((((.((...(((((((((((((((((({..((((((......))))))..........{((((((.((((.(((((((..(((((............)))))....))))))).)))).))))))}..)))))))))))}............,)))))))..,,,,,.........|||}},{.....{(((((((((((,(((((((,..{((((....)))).,...}}|||||.((((((,....,)))))),|||||..((((((.((((((....(((((....)))))......))))))))))))....(((.(((.((((((.(((((((.{{.(((({({{,,,,{(({{,{{||{{,,,,,},|.,(((({{,,.{{{{{.{,,,.....,.}|}}}..((((((((((((.........))))))))))))..(((((....))))),,{{,,.,,,,,|{||||.,|,{{{|,{{{{,.,,))))}}}}}.},}}}}|||,,.}})))}.,})))))).).)))))).))).))),,,...{((((.((({{{,{.....,,))))))).}))}}.....},,((((((((((((((((...(((((((((..(((((((.....)))))))..........(((((((((((((((((((((((((.....,,......{{((((((....}}}}}}}}...,..{((((({{{{{{,||}||{((..{(({....}}}}..}}|||.|||||,((((.,.((((,{({(,(((((.{{{(({{{..,,{{||,,,.,..,,{,,..||}}...}})}}}.)}}))}||,}}.)),)))),}}}))|||..(({{(.((({{....{{{((({,,,,,,,{,,..,,,..,.}}}})))...)))))))))),|.,|{||.||||}}}}||,{{{{,{{{(((,,,{{{{.....,|||||{|,,,,,,..))})))).}}}}}...{{{((((((((((,....,,,,..}}}}}))))))....))).})))))))}}}......{{{.....}}}.....))))))).))),.})).))))))))))))....{(((((.{..(((.........)))...}.)))))},,.,{((((({,,(((,((({{{{,,,,,,..((((((((......)))))))).,{{{,|||,..,{|{,...|||{{.,{({.(((((.....))))).}}},|.||}}|{.,|,||{(((((.....)).))))))})}))|,,,.,{{|.,,,}}|,|},...,.......{{{{{{,,,,,|||}},..,}}}}}}}}}},...,||||.,,,,..,},,.(((.{(((...........)))).)))....||,,,.,........,|)}}}}}}})))}}...||||,...}},,}},,|,|,.....{(((((.......)))))}....)))))))))...))))))))).))))))).(((((.((((((((((((((((........(((((((((......(({...}}}......))))))).))........))))).(((((((.((((((,..{{(((((....(((((........))))))))}}}}.,,,...{((({...})))),))))..)))))))((((.(((((((....((......)}...))))))).)))).}))).))))))).))))).{(((((((.((((((((..((((..((((((..........((((........)))).....,))))))..))))...))))))))..,,..,{{(((..((((({{((((((,{,{{{{,((((.,,(((((((((....})))))))...))))...,}}},.,......{((((((((...(({...)))..))))))))}..........{((((((((((({....}.})))))..)))))}...,..((((((((((((({{{....{,{((((((...)))))))}........}}|||(,((,,,..},}},,|,,}}.}}}}..,})))))))))))..,.))))))))))))..)))))){{{{...}))).)))))))).,))))))},.)))))))))))),,.,}},,))}.)))))...)))))...)))))))....))))))))}}}))))))).)},)))))......))))))))))},)))))))}}........)))))).))))))).)),,....)))).}))))))).))})))))}.......))))))))))))))))).,}}}},,||||,.........,}}},..})}}|||,(((((,....{(((((((((.....(((((((((...,.((((..(........)..)))).}...)))))))))(((((((((..{(((((((..(((,.......,(((((....)))))|((((((,.,(((((((((((((((((........)))))))..,,,.(((((.{{{{......)))).))}}}{(((({{,.,((((.{{(({({{{,....)}}..},,,)))}}|||((({.{{{{{{||,.....,((((,.,((((,,,,.}}}|,,,||||..({..((..((((((,.((,.....,.,)})))))))..))..}},..,||{{{({{{,...,}}}}|{||{{.{{{((((((......}).))),..,,....))),.}}}}},..,,,.))))))}}.}))))}},.,)))}))))}.)))))))))))))))))},.{(({{{,((((((,...,...{{,.....|.|||,,.,.,))))}.,)})))))}...{(((((((((((......((((.....}}}}...........(((((((....))))).))........((.(((((((((((......))))))))))).)){{{{,.{((|{{{{|(({{{.((((((({,....((((((.....))))))...{((((...,,{{.(((((((((..((((((({((((....(((((((......)))))))..))))))))}.,))..)))))..))))}}.,,))))}{{{{{{.,{{{{{{,.{{{,{...((((((..,........}))))))..||..,}}}}),,.....(((({{{.,,,((((..,((((.((.....))})}},)))}}))))))}}..}))}..{{{,,,.,,,,}}}}))))),.....{(((..((((((((((....(((((.......)))))....))))))))))..))))})}),)))))|},..,}}))).))})}.))))))))))))))).))))))}.}..))))))))).)))))))))))))))..,,}))))).))).}}}..,,,............,,.,,||,}|.......{,|||}......))),,...

Transcripts

ID Sequence Length GC content
GAGUCGCAUCCUACCUGUUUGGGAGGUGCACUGCCUUUCCACACUCUCC… 6758 nt 0.3286
Summary

The protein encoded by this gene belongs to the ligand-gated ionic channel family. It is an integral membrane protein and plays an important role in inhibiting neurotransmission by binding to the benzodiazepine receptor and opening an integral chloride channel. This gene is clustered with three other family members on chromosome 4. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human postmortem brain tissue demonstrated that the GABRG1 mRNA is significantly increased (2.3-fold) in the hippocampal dentate gyrus of individuals with alcohol dependence compared to controls, with no significant changes detected in the orbitofrontal or dorsolateral prefrontal cortex [Jin et al. DOI:10.3389/Fncel.2011.00030]. A separate review of human alcoholic brain transcriptomics also identified lower expression of the GABRG1 in the hippocampus of alcoholics [Warden and Mayfield DOI:10.1016/J.Neuropharm.2017.02.017].