Basic Information

Symbol
GABRR2
RNA class
mRNA
Alias
Gamma-Aminobutyric Acid Type A Receptor Subunit Rho2 Gamma-Aminobutyric Acid Receptor Subunit Rho-2 GABAAR Subunit Rho-2 Gamma-Aminobutyric Acid Type A Receptor Rho2 Subunit Gamma-Aminobutyric Acid (GABA) A Receptor, Rho 2 Gamma-Aminobutyric Acid (GABA) Receptor, Rho 2 GABA-C Receptor, Rho-2 Subunit GABA(A) Receptor Subunit Rho-2 GABA(A) Receptor, Rho 2 GABA(C) Receptor
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Drug abuse diagnoses

MANE select

Transcript ID
NM_002043.5
Sequence length
4738.0 nt
GC content
0.4641

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1565.90 kcal/mol
Thermodynamic ensemble
Free energy: -1653.02 kcal/mol
Frequency: 0.0000
Diversity: 1268.80
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((.......))).((((((....(((.........(((((((..((.......(((((.(((.((..((((((((..((((((((.((((.((..((((..(((((((.(((((....((....))...))))).))........(((((((.......).))))))..)))))..)))).)).))))))))))))...)))(((..((((((((((...(((((........)))))...))..(((((.....((((......))))..)))))...((((((((((((...(((((((((...(((((((((((..(((((((((..((((.((((..((((((.(((((((((.(((.....)))))))(((...((.(((((.....))))).))..)))))))))))))).(((((......)))))....(((((..((((...((((((..((.((..((((((((..((((((((.(((.....(((((((...((......))..((((((((((((((((.(.((...)).).)))))))....)))).......((((((...(((((((((((..((((((.....))).).))..)))))...((((((....))).))).....))))))....))))))....((((((...))))))....)))))........((((....))))...)))))))))).)))))))))))).)))).(((((((.........)).)))))(((((((..((((((....)))))).....(((((((........))))))).((((((((...))))))))........)))))))((((........))))..))))..))))))...))))..))))).....)))).)))).)))).................)))))................))))))))).))...)))))....)))).))))))))))))....((((.((((((((((..((((((((..((((((.......(((....)))....((((((.(((((.((...((((((..((((((((..((((.....))))...)).)))))).....(((....)))(((((((.((((((((((((((.(((((..(((((..((....))..))).))....))))).).))))))))...))))))))))))(((((.....))))).((((.......))))..))))))....)).))))).))).)))..(((.(((.....))).))).......((((((((((.(((((((((((...(((((.(((.........(((...((........(((((....)))))......))...)))....))).)))...))...))))))))..)))......((((.(((..........))).))))....(((((((.((((...((((((((........................))))))))...)))).))))))).......((((((((((.(((((((.........(((((.((((...((((((((.((....((((...((((......))))))))..)).)))))((((((......(((((((((((((((...(((((.((....(((........)))..)).)))).)...)))))...((.(((((...(((((((((((((((((((((((.((((((((((.(.((...(((((((.(((((((.((((((...(((((((((.((......)).)))))))))..((((((....(((...........((.(((((((.((.(((.((...)).))).)).))))))).)))))..))))))...((......)).......((((...((((...(((((.((((..(((((....................)))))...........((((....)))).)))).)))))((((.(((((((.(((...(((((((.....)).)))))((((((((..........))))))))..............(((((((((((((((((.............(((..(((........))))))....((((((((...)))))).))))))))....))))))))))).((((((((...))))))))..((((((((.(((....))).)))).))))))).))))))).)))).......)))))))).....(((((.....))))).((((..(((((........))))).....)))))))))).)))))))..(((..................)))......))))))).)).))))))))........(((...(((......))).)))))).))))))))))..)))..)))(((((((((((((.((....))..)).))).))))))))...)))))))))))).)).....)))))).)))).....))).))))))..))))..)))))(((((((((((..(((((..(((((.((((....(((((............((....)).............))))))))))))))..)))))............((((((((((((((((..(((((.((((.((((.(((((...(((((((((.....)))))))))...)))))))))))))..............((((((.(((((......................))))).)))))).....((((((.......)))))).))))))))).............(((.(((....)))))).......((((((....(((...((..((((....((((........)))).....)))).))...)))......))))))..))))))))))))..(((..((..(((.......)))..))..)))....)))))).)))))..))))))).)).)).))))))(((.((((((((.(((((((.........((((((...))).))).....((((((((.((.((((((.((.....((((.(((.(((((...............((((((.((.(((..(((((((((((((((((((((((((((..(((((((((((((.((.((((((((((((((((((((((((((((.(((.....(((.((..(((((((..((((((((((.((((.(((((((((((((((((((.(((((.((.((((..(((((((((...))))))))).....................((((((....))))))...((((...))))(((...(((((((((((((...)))).((((.((.(((....)))))))))((((((((..(((.......)))..))....))))))......))).)))))).))).(((..((..((((......)))).))..)))((((((.(((((((.((((((((((..............(((((((((.((((..(((((..(((.....)))..)))))..)))).).))).)))))..(((((((....))).))))(((((((.((.(..((((..(.(((...))).)..))))..).))..((((((.((((.((((((((...))))..........................)))).)))).))))))...)))))))..)))))))))).))))))).)))))).....)))).)).))))).))).)))))))))))))))).)))).))))))))))..)))))))..)).))).....))).)))))))))))))))))))))))))))))).)))))))))))))..)))))))))))))))))))))))))))..))).)).))))))))))).))).)))).)))))))).)).))))))))))))))).)))))))))))((((.((((((((...((((((.....)).))))......)))))).))..))))..))))))))))........))))))..))))))))..)))).)))))).))))......(((((((((...)))))))))...........)))))))).)))((((((.((((((((((((....(((((((((((((..((.((..((..((((.(..((((.(((((....(.(((((.((((((..................(((((((((((((((((((.(((((.(((((.....((((((.............)))))).(((((......))))).....(((((.(((((((((((....))))))))....))).)))))...........))))).)))))((((((.....)))))).........))))))...(((.......)))))))))))))))).))))))))))).)......)))))..))))).))))...))..)).))...))))).))))))))..((((....))))....)))))...))))))).)).))))((((((...((...))...))))))((((((((((......))))))))))..(((................)))...)))))..))))).)))))......))..)))))))..........)))..))))))..................((((((........)))))).......
Thermodynamic Ensemble Prediction
(((((({{..((,(((.{(((.({..(((({((,,,(((,((((.{{,{,{.{{((((..((((((..{((((((({.((((((((.(((({((,.((((..{{(((((.{{{{||..,,,,{,,||,,,|||||.||,,,.....(((((({.,.....),})))))..}}}}},,|))}.,|,))))))))))))...)))..,..,{(({,,(((...(((((........)))))...)),.|||,|}}...,,,,.....,))))..}))))},.|||||{,,,((({,{(((((((((,,.,.((((((((({{(({{{.(({.{(({{.{{{(,((((((,{{(((((({.,|||.|||{||||||{((((,.((((((({(((({(({,,....}}.}})))||{{{{{.{{,{{.,,}}.}},,}.,)}}}}))}}|||||.||}}}}}..{{{,{{{(({{,,{|}}|||||{((.{{{|,...,{{{|||.|.||,,,,,.))}.||||{|||{{||||{{.||{|,,,)}}).)))}}}}}|,.,,,,.......|{||||||,|||,|||,,,{..{{,{({.....}},,)}))}})|||||{.|,,.,))}},}{|{{|,...,})))},},,..,}|||}...,((((((...)))))).,..,,))).,,,}}},|||{.,,,)}}),}})))))),,)).))))))),)),,.}}},.{,{(({{....,,,}.}},))))}(((((((..((((((....)))))).....{((((((........))))))).{(((((((...)))))))}........)))))))||||,,,.....}}}|{{{....))))||{,{.,,...|||||{{{{{|||||{{||||}},},.,,.,{{{..{{{{{{|||||{{......,,,,,,.,,|||||,||{||{..,))))}}..))))}|||,,,,)))||{{..((((.((((((((((..((((((((.,{{(((,{{{.,,,.,|||{{.,,,|,.{{{{({,((({{.((..,(({(((....(({|(({{((((...,.|||,...}}}}))))},||||{{{...,))){((((((.{(((((((((((((.(((((,.(((((..((....)},,))).)).,..))))).).))))))))...))))}))))))|(((((,...,))))),|,||}}}}}}.})),..)))))}....)).))))).))).)))..||,.|||},.}})))||||....,)}|(((((((((.,(((((,,(((...{{((,.,...........|||...,{......,,{||{{..,,))))|{,.{{{{|{..}}}..}))))))}}...,|,|||||}|||}..||||.....((((.(((..........))).))))....(((((((.{(((...((((((((........................))))))))...)))}.)))))))..,,.,,(((((({{{,.{{{{|||}}}}}..},(((((.((((...((((((((.(({.,,(((,...{{{{......}})}))})},,,.))))))}.,,,......(((((((((,{((({...{((((,((.,..(((..,,,..,)})..)}.)))}.}...)))})}},|{{(((((...((({(({{(((((((((((((((.{{((((((((.(.((...(((((((.,((((((.((((((...(((((((((.((......)).)))))))))..{{{(((,.......,,,,..,...((.(((((((.((.(((.((...)).))).)).))))))).)),})}|||}||}...((,.....||,{{((....|||,.((((..,(((((.((((..{(({{.,,,,,,,..,,........}}}}}.......,}}..||}},,,,,}},)))}.)}}}}|(((,(((((((.(((...(((((((.....)).)))))((((((((.,........))))))))..,{{,......,}||(((((((((({{{{{.............{{{..{((........))}))}....|||{((((...)))))),}}}})))}|...}))))))))}}.((((((((...))))))))..((((((((.(({....))).)))).))))})).))))))),))}},,,....}}}}}},,.,...(((((.....))))).{(((..(((((........))))).....)))))))))).))))))}..{({....{,............}}},,,,,.))))))).)).)))))))),......,(((...(({,.....|}}.}}}))).))))))))))..})),,||{(((((((((((({.((....))..)).))}.)))))))),..}))))))))}}|.)}.....}})))).}})).....))),)},},,..))))..)))))(((((((((((..(((((..(((((.(({(||,,{{{{(,,,,........,|,,..)),.,,,}....,,}))}}})))))))))..)))))............((((((((((({(((,..|||,{{(({(.{(((((((((...(((((((((.....)))))))))...))))))))))})}....}}}|,,{{..((({{{.{{{|{|||{..,,,,,,...,,,,.{,|||}|,||||||,,...((((((.......}))))).||||}}}))............{((({,,,....)))))}..,....{{{|||.|..{((...||}.{{{{....((((........))))..,,,)))),}}.}})))..,}},))))})..)))))))))))}.,(((..((..(({.......))),.))..))),...)))))).)))))..,))))))})},)).))))))|(,{((((((((.(((((((.........((((({...})).))).....((((((((.((.((((((.((.....((((.(((.((((({.,............{{((((,,,.(((..(((((((((((((((((((((((((((..(((((((((((((.((.((((((((((((((((((((((((((((.(((.....(((.((..(((((((,.((((((((((.((((.(((((((((((((((((((.(((((.((.((((..((((((((,...}))))))}}.,.,,..,,..,,|},,.,..{(((((....))))))...((((...))))(((...((((((({(((((...,}}}.((({,((,{{{.,,.)))))}))}((((((((..(((.......)))..))....))))))..},,.)),})))))).))}.(((,,({,(({,(......,))).)),.)))((((((.(((((((.((((((((((..,{,,...{{,,.(((((((({.((((..(((((..(((.....)))..)))))..)))).}.)))))))))..(((((((....))).)))){{||||,,||,{..((((..(.(({...})).)..))))..|||,..((((((.((({.((((((((...})))...,,.....................)))).}))).))))))...))))}})..)))))))))).))))))).)))))).....)))).)).))))).)))}}))))))))))))))).)))).)))))))))).,)))))))..)).))).....))).)))))))))))))))))))))))))))))).)))))))))))))..)))))))))))))))))))))))))))..))).,).))))})))))).))).)))}.)))))))).)).))))))))))))))).)))))))))),((((.((((((((.,.((((((.....)).)))).,....)))))).))..))))..)))))))))}........,,,},,..))))))))..))))}}))))).))))))},..(((((((((...)))))))))........,,,||{{{,,,,{,,}|,,{(((({{{,,.((((...(((,.((((((((({.({...((((((((((...,((((((((...((((((((..((..((....{((,,{{,.......}}}},}}.,))..))..)))))))).{(((......{(((((.............)))))}.,,,,,}})}{{,.......}}.)))))))||(((((((....)))))))}....,.(((((((.,{,(((..,....,,)))...((((((.....))))))......,},.))))))).))))))))))....)}))))))))))....)))......)))}.})))}}},.},.|||}.,.,...}}}))))},)))))))),.})})}}|||,.....,||}}(((((({.{,((({,{{{{{..,{{{{((((((,..{{...}}..,)))))),{|||||{||,,....}}}))))))}..,,|...............,|,,...,,|{{....))).,}))),,..,}))..))))))),{||......))},,,,))))}.....}}}}}}},,))}.....,.....})})},,.,.......

Transcripts

ID Sequence Length GC content
GGCCAGCCUUGCCCUCACAGCCCCUCAGAGCAGCCCGUCAGGAGGCAGC… 4738 nt 0.4641
Summary

Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA receptors, which are ligand-gated chloride channels. The protein encoded by this gene is a member of the rho subunit family and is a component of the GABA type A receptor complex. This gene exists on chromosome 6q next to the gene encoding the rho 1 subunit of the GABA type A receptor, in a region thought to be associated with susceptibility for psychiatric disorders and epilepsy. Polymorphisms in this gene may also be associated with alcohol dependence, and general cognitive ability. [provided by RefSeq, Apr 2016]

Forensic Context

A study in mice demonstrated that the GABRR2 was downregulated in the corpus callosum-external capsule at 2 days post-injury, a change unique to that brain region [Kounelis-Wuillaume et al. DOI:10.1177/08977151251390528]. In human postmortem brain studies, the GABRR2 was identified as a primary network contributor in the prefrontal cortex associated with lifetime alcohol consumption [Warden & Mayfield DOI:10.1016/J.Neuropharm.2017.02.017].