Basic Information

Symbol
GADD45B
RNA class
mRNA
Alias
Growth Arrest And DNA Damage Inducible Beta GADD45BETA MYD118 Growth Arrest And DNA Damage-Inducible Protein GADD45 Beta Myeloid Differentiation Primary Response Protein MyD118 Negative Growth Regulatory Protein MyD118 DKFZP566B133 Growth Arrest And DNA-Damage-Inducible, Beta Growth Arrest And DNA-Damage-Inducible Beta Myeloid Differentiation Primary Response
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_015675.4
Sequence length
1371.0 nt
GC content
0.5740

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-522.30 kcal/mol
Thermodynamic ensemble
Free energy: -546.33 kcal/mol
Frequency: 0.0000
Diversity: 369.26
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((((.....(((....))))))))(((((((.....(((((.....(((((((((..(((((((....(((((((((.......))))))))).....))).....))))..))))).))))...)))))...)))))))((((((((((((((((((.((((((..(((((...((((.(((......))).))))(((((.....)))))..(((((((((((......(((((..(((.((((((.((((((((((.((((.(((....(((((((((.(((((((.((.((((((.(.((((((((.........)))))))).).)))).)).)).)).....(((((((((((((((..((.((((((((((((.((((((.(((((((.((((((.(.......).)))))).))))))).))...(((((((...(((.((((..((((.(((.(((.((((((((((((...((((........((((((((.((((((.....((((...)))).((.((((((..............)))))))).........)))))).)))))))))))).....)))))....((((.(((.((.((((((.....))).))))).))))))).((((.(((.(.((.......)).).))).........((((((((((.(.(((((((((((.....)))))).(((((((.(((((((..((....)).)))))))...............(((.......)))...((((((..(((((((((....(((((.......(((.......).))......)))))....)).)))))..........))..)))).)).)).)))))(((.((.((((((((((((.(((......))).)).)..))))))))))).)))...))))).))))))))))))))))))))))))).)))..(((((.((....)).)))))...)))).))))..)))...)))))))..))))..(((((((.......)))))))........(((((((((((((((.((..(.(.....))..)).))))))))...)))..)))).)))).)))))))).))...)))))))))).)))))..))))).)))))))))..(((..((((.(((.....)))..)))).))))))..))))..)))).)).)))))))))).)))))))))))).)))))))..(((((......)))))..)))))......)))))).)))..))))))((((((((((..((((....)))).))))))))))...((((((...))))))........))))))))).
Thermodynamic Ensemble Prediction
.,,.,{({(((({.,({{,,,({{|,,|||{}||({{,,,{{(((({.....,..,||{{||,{{||||{....((({(((((,,,,,..|||||||||.....}|}||||,}))}||||||},|((((......)}}},}}})}}||||{,{((((((((((({(((,,,.((((((({.((((.(((,,...,}}|.}}}){{{{{,,,.,))))).....})))))))..}}}.|||}}..})))))|{|((((,{,...}))),})||{.....|||{{{{||.|||||{{|||||||{{{.|,{{{{|||({{..,...}))))}})}.},}}||.}||||||}||,..(((((((((((((((..((.((((((((((((.((((((.(((((((.((((((.(.....,.).)))))).))))))).))...(((((((...(((.((((..((((.(((.(({{(((((((({({{...(({,........((((((((.((((((..{,.((((...)))).|(,((((((....,.....,...)))))))).........)))))).))))))))||||,,,{{||||}....((((.(((.((.((((((.....))).))))).)))))))|((((.(({.{.{(.......)).},})).....,,..((((((((((.{.(((((((((((.....)))))),(((((((.(((((((..((....)).)))))))...............,,,......,))}...(,(((({,({((((({(....(((((.......{({.......}.))......)))))....)).))))).,.||.....))..)})),)).)).)))))|((.((.((((((((((((.(({......})).)).}..))))))))))}.)))...))))).})))))))))))))))))))))))).))}..(((((.((....)).)))))...)))).))))..)))...)))))))..))))..(((((((.......))))))),|||....(((({{{((((((((.((..(.{.....})..)).)))))))),.,))).,)))}.)))).)))))))).),,..))))))))))},))))..|||||,|||||,},,..,,,)})))))))}....,{(((({.((((.((.(((((.......))))))).)))).}...)))))},.,{{{{{..{((((,....}}}}},)))),.,}}))}|||{,,,||||,.}}}.}))))))|||,||||||,,|{((,...))}}.}}}}}}}))),,...,|||}}},,,,.},.......,}}}})))}.

Transcripts

ID Sequence Length GC content
AGAUCGCCGAAGCGUCGGACUACCGUUGGUUUCCGCAACUUCCUGGAUU… 1371 nt 0.5740
Summary

This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The genes in this group respond to environmental stresses by mediating activation of the p38/JNK pathway. This activation is mediated via their proteins binding and activating MTK1/MEKK4 kinase, which is an upstream activator of both p38 and JNK MAPKs. The function of these genes or their protein products is involved in the regulation of growth and apoptosis. These genes are regulated by different mechanisms, but they are often coordinately expressed and can function cooperatively in inhibiting cell growth. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the GADD45B was analyzed via qRT-PCR as a candidate gene from a microarray screen of cerebellar tissue following traumatic brain injury [Schober et al. DOI:10.1007/s00414-014-1129-3]. In porcine skin, research showed the GADD45B was significantly increased in response to sulfur mustard exposure at seven days post-injury [Price et al. DOI:10.080/15569520903097754].