Basic Information

Symbol
GALNT3
RNA class
mRNA
Alias
Polypeptide N-Acetylgalactosaminyltransferase 3 GalNAc-T3 Polypeptide GalNAc Transferase 3 HFTC HHS UDP-N-Acetyl-Alpha-D-Galactosamine:Polypeptide N-Acetylgalactosaminyltransferase 3 (GalNAc-T3) UDP-GalNAc:Polypeptide N-Acetylgalactosaminyltransferase 3 Protein-UDP Acetylgalactosaminyltransferase 3 Pp-GaNTase 3 EC 2.4.1.41 Polypeptide GalNAc-Transferase T3 GalNAc Transferase 3 HFTC1
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_004482.4
Sequence length
3436.0 nt
GC content
0.3763

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-864.58 kcal/mol
Thermodynamic ensemble
Free energy: -937.17 kcal/mol
Frequency: 0.0000
Diversity: 1119.04
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((((....(((....)))((((((...)))))).(((((....)))))..(((((((((...((((...((((((.((((((((((.((..(..((((....))))..)..)).).(((((..(....)..))))).)))))))))..(((.((.(((.((...))))).)).)))..))))))...)))).))))))))).....((((((((((((((((((((((((........)).)))))(((((((((....(((((..........(((((((((((............)))))))))))....(((((.........)))))((((.(((((((..((((..((((.....................................))))..)))))))).))).))))..((((((((.(((((...((((((..((((((((((((...(((((((..(((((.....)))))...((((((.(((((...................(((((((..((((..(((...)))..)))))))))))..((...)).(((.......))).(((((....)))))(((((....((.(..(((((.((.((..(((((....)))))...))...)).)))))..).))..))))))))))..))))))...((((........(((..(((.((((((((((((....(((((.((...........)).)))))(((((.......(((.(((((((((((((................))))))(((.(((.(((((((((........)))))))))...((((((.(((......))).))).)))..............))))))............(((((..((.((((.((........)).)))).)))))))))))))).)))...((((....))))((((((...(((.(((..(((.(((((((((((.......))))))))).)).)))..))).))).))))))...........((((...(((.((........)).)))..)))).......(((((((...............)))))))...)))))..)))))))))))).)))..)))....))))((((((((((...............))))))))))(((((((((((((((........)))))))).(((((((.........))))))).((((.........))))..)))))))..)))))))(((((.......))))))))))).((((((......))))))..((((...((((((.(((.((.((((((((..((.......((((((.......).)))))......))..))))))))...))))).))))))...)))).))))))..))))))...(((((..((((((.....))))))......)))))))))).)))))))))))))...)))))))))(((((((((....)))).)))))......)))...).)))))))))((((((((((((....(((...((((((((........)).)))))).)))...))))).)))))))..)))))))))))))..))).........(((((((.(.(((....))).).)).)))))..(((((...(((((((.((((((((((((((.((.((((...((((........)))))))).))))))((((((....)))))).....((((........)))).((((((((....(((((.((((((((((((......)))))).(((((((............(..(((((((.((((((.........((((..((((((.((..((..(........)..))..)).))))))..))))......)))))).((((.(((.(((((((((....))((((.......)))).(((((..(((((((...((((((......(((((((...(((((((((.((((..(........)..)))))))))))))((((((....)))).))..(((....))).(((.....))).((((((((((((....)))))...)))))))...))).))))......))))))))))).....))..))))).)))))))..))).))))........(((((....(((((((..(((.(((((((((((.((((((((((((((((...............))))(((((((((((((((((...(((.(((............((((((((((........((....))((..(((((((.(((.....))))))))))..))..............(((.((......(((((((((.....)))))))))......)))))..............))))))))))........)))))).))).)))))))).))))))(((((((.(((((((...)))))(((((..((((..((((.((.((((.((((((..(((.((((....)))).((((((((.......................(((((((((....)))))))))..........((((((((..((((.((....)).))))....))))))))....))))).))).....)))..)))))))))))).))))..((((((((..((((........(((((((((((((((((((.............))))))))))).((((((...((((((((..((......))..)))))))).((((.........)))).......)))))).))))))))....))))..))))))))..))))..)))))....(((((((...................))))))).)).)))))))(((((((((....(((....(((((((((......(((.(((((...(..(((((((...)))))))....)...))))).)))....((((....(((((.......)))))....))))..(((((..((...(((((.(((.((((.(((.....(((........)))..))).)))).)))..)))))...))..)))))((((...(((((.....)))))...))))....)))))))))....))))))))))))..............))))))....))))))))))))))))).....)))..)))))))....))))).....(((((((((((..(((((...................)))))...)))))))))))...........)))))))..)...))))))).......((((((......)))))).)))))))))))...)))))))))))))..))))).))))))))))))..........
Thermodynamic Ensemble Prediction
.((({{(,(((({,..|||,.||)||{(((((...})))))}|||||,.,,)))}}..(((((.(((...(((((..(((.(((((((((((({(.(,(((.((({..,,|}||,((....|||((,.{.|{....|..|},}|,|.,|||||||..,},...|||||,...)),,},}},,})),))).))).)))))))))))).)))..)))))...)))..))))).{(((,{{,,,.....}|,|||}|,{{{{(({{(({{.((({.(((({.,..{{{((((((((,,,,,,,,,..,||||}}}||||{...,|||||,{{{{,{{||||,,{{{.((({{{{..,|||..{{{(,,....,,..,,,},,..}...,,|........,,|,}})}..)))))))),))).}}))}}}},)))}}.,}}}.}|||{|,,,,,,,,...}}}}}},|||||||{...(((((.....))))}...{{({({,((((({{.,.....{{{....((((((,.((((((((((((((((((,,.,...|,,,,,,.,((((((..((((,.....,,...,(((((((((.(.(((((....,{,(..(((((.((,.,..(((((....)))))...)).,.)),))}))..,.}}..))))).}.((((..((((......))))))))........))))))))))))}..)))))}....,......,,,.,}||||},|.|}}.{((((((((((,...(((((((((...({{{.{{{{{{.{(({{,..|{{(((.(((((((((........)))))))))...{{{(({.{{,..,..,|||,|||.{{|{{({{.,,,,((((.({,,..((((.(((((((((((.{.(((((((.{{{(((,{({{...|.{(((((...))))}|.,.,,,}||||..,.}}|}((((((.,,(((.(((..(((.{{(((((((((,....,.}}}}})))),}}.)))..}}}.}}}.}}))))|,,|}}|},.,}}}},,,||..,||,....,.,}}}}}},}}}}.......(((((((...............)))))))...{((.,.((((({...)))))).,..}}}.,,|,.((((((((((((...............)))))))))))).,{{{{(((((((......,.)))))))|.{((((((.,.....,.))))))),....{{{{{,,,.{{{{.{{{{{{{.,,,{,{...(((((.......))))).|||{{,||||||,.,...)))))...((((...((((((.(((.((.((((((((..((.....,.((((((.......).)))))......))..))))))))...))))).))))))...))))..,,},})},|||,,..{{(({(,,((((((.....)))))).,,,..})))}}||||,,}},},,.,}}},..||||{|{{.{(............)),)}}}})))}.))))))).})))))))))))..))))...|{|||||}{{{{.|||||{||({{({{{(((..(((((..(((......(((({....})))).....)))..))))).)))}....|{(({((.{,(({....|||,|,||,||}}}..{{((({{(((((.{{{{{{|,|{,.(((((((({.{({{{.,(({..,{.....{{{{{{((((.,.(((((({....})))))).....))))|,,....(((((({...}))))))})}.|||{.{{{{|||||,,,,,,)))))}.}))..)))},..,,,..{{{,{|..(((((((.{..(((((((.{((((,..((((((((((((((((((.{{{,....,,|||.||,{{|...,|,,.....,||....((((.((({(((((((((....)){{{{.......}}}}.(((((..(((({{{...((((((......(({((({..,(((((((((.((((..(........)..)))))))))))))|{{(({....}))},,,..|||..|,))}.{{{,,..,}}}.((((((((((((....))))}..,)))))))...))).))))......))))))}}}}}....,))..))))).)))))))}}})).)))).........,,,{,,.,|||.....,||||{{{{{|,|,...}),))}|||||}|(({,....,,||,{{{.{{((((....}))))).}||.....,}||},..,|},|,},,},((((((((((.......{((....))|{..((((((,{(((.....))))))))))..},......,....,{{(((.((......(((((((((.....)))))))))......))))}.,},...},},,..))))))))))}}}..}))))))))))))))))).,|{{,{{{,(((({,,,.,{{,{,,,..{(({((..,,...((({{({.{(((((,..((((..{..,.,..|||,..,})}}}}.})))..)))}}},,}}}.........,,,(((((((({....})))))))),,}))}}}..{{{||{{|,,||{{{{{|,..,,.}},},,,,}}}}||||..,,,|}||,,,|,,}}}}.,}}}}},}},.)))))..)))))))..}))))))}.,.}}.}}).,,})}}))),|}},}}),,)))}))))))))),,)).))}.})))).})))))}|}}}||}}}}}}...,}},.}})))))}})}))}},,,,,,},)))))}}}}.)))},,.,,},|||,|,,,,},,,,)}}))}...,,,,,.}}})))}}}}|.,,{(({{...,,,,...)}))}..,,,,|||{....,}}})))})))}}}}})..||||{{{{.,,,.,.,||,,,.,,,,,....,...,,,,}}))))))))))))))))))))))))))))............)))))))...))))))..,||}}}|{|,.....,,,||||,|{|,|||||||||,|||{||||||||}}||.,,|}}|||,||{||,,{{{{.,,,}}}}}||}||||||,|{{{,..{{(((.....))))),..)}}}......{{{{{{{{...((((.....))))}))))))}|{{{{.|{,{{{{{||,||{,.,,|||||{|,{{({.{((......))).)))),)),}}}}}}}||||||||{}}|||,,..{{{{{{{{,.,{{|,|,||}}|.||)}||||||,||{{{....((((.(((....))).)))).}}}},.,}},{(((({.,,,,,))))}}}}}},...,},|||||||,|}}.}},,.}.,,}}}}),,..))))}}}.}))......

Transcripts

ID Sequence Length GC content
AGCUCACCUGGGAGACUCCAAGUGGAAGCCGAGCCUCGGUUCUGCCUCU… 3436 nt 0.3763
Summary

This gene encodes UDP-GalNAc transferase 3, a member of the GalNAc-transferases family. This family transfers an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. Individual GalNAc-transferases have distinct activities and initiation of O-glycosylation is regulated by a repertoire of GalNAc-transferases. The protein encoded by this gene is highly homologous to other family members, however the enzymes have different substrate specificities. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that in vivo α-particle irradiation of Kupffer and endothelial liver cells induced a characteristic inflammatory state, with the GALNT3 (Galnt3) being commonly down-regulated by less than half in all irradiated groups compared to non-irradiated controls [Roudkenar et al. DOI:10.1269/jrr.07078]. This down-regulation was part of a broader gene expression profile distinct from chemical hepatotoxicants, characterized by the suppression of cytochrome P450s and the induction of Metallothionein 1 and Hemopexin.