Basic Information

Symbol
GALR1
RNA class
mRNA
Alias
Galanin Receptor 1 GALNR1 GALNR Galanin Receptor Type 1 GAL1-R GALR-1
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_001480.4
Sequence length
10749.0 nt
GC content
0.4322

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3328.80 kcal/mol
Thermodynamic ensemble
Free energy: -3541.12 kcal/mol
Frequency: 0.0000
Diversity: 2605.41
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((.........)).((((((((((((((((((((((......(((((.....((.(((((......)).))).)).....)))))((((((....((((.((.....))))))..))))))...(((((((((((((.....))))).))).))))).)))).))).))))).).)))))))))((((((((((....(((((((((((.((.((((.(((((((((.((((((((((..((((.((((.((.((..........)).)).)))).))))(((((..(((((...((((((((.......((.(((.((.(((.(((((((....))))))).)))..)).))).)))))))))).))))).)))))....))))))).))).....(((((((((((((.((((((((.((....(((.((....)).))).))))))))))((((.(((.......(((....))).....))).))))((((..((((((((((((((((((((((..((((((.((((((.(((..........))).)))).)).)))).))((((.........))))......)))....)))).))))))))))))))).))))........)))))))......))))))....))))))))))))).)))))((((.(((....))).))))((((......))))(((.((((((((((((((((((((...((((.(((((((((.(((.((..(((((..(((((((.....((.(((((((((((.((...)).))))))))))).))..)))))))..))))).)).)))...(((((((....))))))).(((((.((((((((((.(((((..(((((((.((.(((..((((......((((..............(((((..(((.....))).....)))))...............)))).....)))).))))))))))....)).))))).)))))((((.((((.((((((((((...(((((((((((.((....))))))))((.....(((((((((((((((((.(((((.((((...))))))).)).))).))))))).............)))))))....)).(((((((((((((((((((.((.....((((.(((......(((((((......))))))).......))).))))....))))))))).))))))((((.((((...(((((.((((((((((.(((...((((((.((.....))..)))))).........)))...))))).))))).))(((((((((((..(((...((((..((((((.(((((..((((((.......))).)))((((((((((((((.(((((((((.............((.((((.((((((((..(((((((((((((((((..((...((...))...)))))))))......((.(((.((..(((((((((((.......((((((((((((.............................))).))))).)))).....))))((((((.....(((((..((((((((.((((((...)))))).)))..........)))))..)))))....))))))..)))))))..)).))))).((((......))))...(((.....)))((((((...(((((((...((((((.(((.(......).))))))))).....)))))))((((((((....)))))...)))......(((((...((((((..((((((((((.......(((((((...))))))).......))))))........((((((.(((((((....(((.((.((((....((((((...))))))((((((((((((....)))))........(((.(((((((((((((((((((((.......(((....))).(((((((((((((.((((....)))).))((((((((((((...)))))))))))).........(((((((((((((((((.........)))))).....)))))))))))....((((((((((.((.(((.....))).)).))).)))))))((((((.......))))))....(((((((..(((((.(((.........))))))))...))))))).....((((((..(((((((.(((((....))))))))))))..)))))).(((((((..(((((((.....(((((((...((((((((((((.((....))))))....)))))))).))))))).....(((.(((((((((....((((((((((..((((((..(((((.((..........)).))))).))))))))))).........)))))..))))))))).)))..........))))))).)))))))(((((((....)))))))......((((......)))).)))))))))))..)))))))))((((((((((..((((.......((((((((((..(((...(((......)))..))).))))))))))........)))).))))))))))..))))))....)))))).))).))))))).(((((((.(((((((((((((((((((..((....))..)))......))))))))))..))))))..))).)))).......)))).)).))).))))))).)))))).........((((....))))))))..))))))...)))))((((((((((..((........))..))))))))))...................))))))...))))))))))((((((...))))))...(((((((((.((.((((.(((((.((......))))))).)))).)).)))))))))....))))))))))))))...........)))))))))......))))))))))))))....(((((...((((((((((....))))))))))..)))))...)))))))))))..))))....(((....)))....((((((.(((.((((.....))))..))))))))))))..)))))..))))))..(((((((((....((......))...))).))))))...................))).)))).))))(((....))).(((((....)))))(((..(((((((.(((.((((((.((((....)))).))))).((.(((((((......)))))))))..).))).)))))))))).((((((((...))))))))....((((((((((((((....))))))))))))))))))))(((((((((............((((((((.(((((((((((((((((...((...(((((((....(((((((...((((((.(((...)))..(((((.....))))).......(((((((.((((((.((((((((((((((...(((........)))..))))))......(((((((....((.(((......((((((..............))))))......))).))..)))).))).)))).)))).))).))).)))))))............)))))).)))))))......((((((((.((.(((......))).))..))))))))((((((((((......(..(((((..((..........))..)))))..)...(((((((((((.(((((((((((((.(((((....))))......).))))))))).......)))).))...))))))))).....(((((...)))))(((.((((((((((..........(((((((.(((((((....(((...(((((((((((((....)))))))(((((....)))))............((.((((((...(((((((((((((.((..((((..(((((((...))))..))))))))).))))))))))))).........(((((.(..(((.((((.((((..........(((..((((.(((((((((........))).)))))).))))..))).(((((((((((..((...(((((((..............((((((........))))))..............(((((((.(((((.....((..((((.....)))))).....))))))))))))(((((((........)))))))............)))))))...))..))).))))))))((((((((((((....))..)))))..)))))..(((((((...(((((............(((...((.((((....((((.((((((((((.........((((......(((((((....((((((((..((......)).))))))))..((((((((..(((((((((.((((((...((((......))))))))))))))))))).....(((.((....((((((..((((((((.((.((((((((((((..(((((....((((((((.....)))).......))))))))))))))))).)))).)))))))))).))))))..)).))).....))))))))........)))))))))))........))))))).))).)))).....((((((((((........))))))))))(((((...)))))...)))).))...)))((((........)))))))))(((((((((..(((((((.((((...)))).....(((((..(((((((.(((.((......(((.(.(((((((((((..(((((((((((((((((((...(((((.(((((((((((((.((((.(((..(((((((((((((((.((((((((..........(((.((((((..............(((((..........(((((((((((((((((((((((((((.(......((((((......))))))...((((((..(((((((((......(((((((...(((((((((..((((((...)))).)).))))))).))......)))))))....((((((.......)))))).((((((((...((((....))))...)))))))).(((..((..(((((((((((((((((((((((..((((...((((((...))))))..))))..((((((((.((....))(((((..((((((((..(((...((((...)))).)))..))))).))).........(((((((.....................))))))).((((...))))(((....(..(((((((....)))))))..)...))))))))...))))))))((((((...(((((.((((((.(((.((((.((.((........((.....)).........)).)).)))).))).))))))..))))))))))).....((((((((..((((((.(.(((..............))).))))))))))))))).))).))))).....)))))))))).....)))))..))..)))....((((.((.(((((....(((........)))...))))).)).)))).(((((.(((....))).))))))))))))))..)))))).........).)))))).)))))))((((((((..((((((((...((.(((.(((.(((((((((((..((((((.((((((...(((((.((((((((.......))))...))))...))))).....)))))).))))))....)))))))))).(((((((.((((...(((....)))...)))....).)))))))((.(((..(.(((((((.((..(((.....)))...))...))))))).)..))).)).).)))))).)).........(((((((((((.(((.....))).))))..)).))))))))))))))))))))))))))))).....(((((((..(((.((((((......(((..((((((((((((((((((....(((((((((.......((.((((.((((.(((((((((((.(((((.((((((((.....))))))))...))))).).((((((....))))))((((((...)))))).(((((((.(((...)))...)))))))....((((((.......))))))................((((((((..((((....))))..)))))))).(((((((((((((((((.((..((((((...((((((...(((((..(((((((.((.......))..)))))))))))).))))))......))))))..))))))))))..............................((..((((((((...............))))))))..)).)))))..))))...)))))).....)))))))).)))).))((((..(((((.((((((........)))).(((((((....)))))))........)))))))....))))......)))))))))))))))).(((..((((...(((.(((((((((((((.((((((.........(((((((((((.((((((((((((...((((((..((((..((((((((((........((.((((.((((((......(((...)))((((((((((.((.((((((.((((((((..((((((.....))))))..)....)))))))..)))))))))))))).)))).((((((((((((....)))).))).)))))....)))))).)))).))........)))..))))))).))..))..).)))))......((((.((((.((((((((((((((((((((((((((....)))))))))))))))))))))))....).)).)))).))))....(((((((..((((...((((((((.((...((((((.((((((............((((((((((((((((.(((.(((((..((((((..........(((........))).....((.(((.(((((((((...(((((((.((((...)).)))))))))(((((.(((((((...(((((((((..((((...(((.(......).)))...)))).(((....)))........)))).)))))..))).)))))))))....)))....))))))..))).)).))))))..))))).......(((((......)))))...(((((((((((.((.((....((.((....))))...)).))..)))))))))))))).))))))))))))))))((((((..(((((((..(((........)))..)))))..))...))))))....)))))).))))))...))))))))))...)))).)))))))........((((....((....))...)))).....................))))).)))))))...))))))))..)))(..(((((((..................(((....))).................((((....))))((((....(((((.......)))))...)))).....)))))))..).)))))))))).....))))))))).))).))))...)))((((..(((((((((((...((((......))))(((......)))........))))...)))))))..))))((((...))))..(((((....)))))..))).)).))))))..)))......)))))).))).)))))))((((..(((.....)))..))))((.((((((.((((........)))))))))).))....))))))...........)))))..)))))).)))(((((...........)))))....(((.((((((((.((....)))))))))).))))))))))).))..(((((((((((.(((((((......))))).))...)))))).)))))..)))))))))..)))))))((((((..((.(((.((..((((((((((((((...((((((((((((....)))....))))))))).(((((...)))))..))))))).)))))))....)).)))(((((..((....))...)))))))..)))))).((.(((((((.....)))..)))).))..(((((((((((...((((.((((((.((....))))))))))))...))).....))))))))...)))).))))))....))))))).)))))..)))))))).)))))....)))).))))))).))))))))))......)).))))))))))..)))))((((((.((......)).))))))((..((((((((((((((((.(((((....((.(((((.(..((((((......))))))..).))))).))...)))).).))...))))))))...))))))..)))))))))..)))))))))..)))))))..))).).)))).)))..)))))))))))))).(((((((((((.((((..((((.......))))...)))))))))).))))).((((((((((.(((.......(((....)))....(((((..(((((((...))))))).)))))))).)))))).))))................))))))...)))....))))))).........(((((((((((((((....))))).)))))))))).........(((((((.(((((((..((((.(((((..(((......))).))))).))))..)......)))))).)))))))...((((((((.....((((...................))))....)))))))).))))))))))))))))).)))........))))))))))((((.((((....))))..)))).)))))))...))...))))).))....))).)))))))..))))))))...))))))))).)))))....)))....(((((((.((((...)))).)))).))).....)))))))..)))).)))))))))..))))))))))))))..((((((((((((((((.((((((.((((.(((((..(((......)))....))))).))))((((((((((((((..((((.(((((...(((........))))))))))))..).)))))))))))))..(((((....)))))...)))))))))).....)))))))))..)))((.(((((((.(((((((.((((((.............)))))......((((((....(((((((((((.((((((((((((((.....(((.(((((......((((((((((...(((((.(......).)))))...)))..)))))))......))))).)))....)))))........)))))))))((((((.....((((((((..((((((((....((((((..((((..(..(.(((((....))))).).)..))))..)))))).....)))))))).......................((..((((........))))...)).....(((((.......)))))))).)))))...))))))..((((((((...........))))))))....(((((((((((.....))))))))))).(((.(((.........))))))..................(((((((...)))))))..........(((....(((((((((..((((..((((((((((.(((((....))..))).)).)))................)))))..))))..)))))))))..))))))))).)))))..)))))).).)))))))......))))))).))............((((((..((.(((.(((((((((((((....((..(((((((((((.....((((...(((..(((((....)))))....))))))).....))))))))))).)).((((((.......)))))).........)))))))))))))...))).))....))))))...))))....)))))))).))........))))).))))).)))(((((......)))))..((((((........))))))....(((((......)))))..((..((((((((....((..(((...........))).....))....)))))))).)).))))))))....)))))..)))))(((((.((((.((((.(((((.........((((..((......)).....)))))))))..)))))))).)))))(((((.((.((((((.....((.....)).....((((.((....((((((((...))))))))....)))))).....((((((((....((..(((((((.....).))))))...)).....))))))))..)))))).)).)))))))))))....((((.....)))).
Thermodynamic Ensemble Prediction
((((((({......,..}}.((((((((((((((((((((((.{....{((((.....((.(({(({......)}))).}}....,))))}((((((....((((.((.....))))))..))))))...(((((((((((((.....))))).)))})}))).)))).))).))))).),}))))))))((((,(((((....(((((((((((.((.((((.(((((((((.((((((((((..((((.((((.((.((..,....,..)).)).)))).))))(((((..(((((...((((((((.......((.(((.((.(((.(((((((....))))))).)))..)).))).)))))))))).))))).))))).,,,})))))}.}))...,.(((((((((((((,(((((((((((....(((.((....)).))).))))))))))((((.(((...,...{((....)})..,,.))).)))),(((..((((((((((((((((((((((..((((((.((((((.(((..........))).)))).)).)))).))((({.{......,))))......)))....}))).))))))))))))))).)))),...,..,))))))).....,))))}}....))))))))))))).))))){(((.(((....})),))))((((......))))(((.((((((((((((((((((((.(.((((.(((((((((.{(({((,.(((((..(((((((.....((.(((((((((((.((...)).))))))))))).))..)))))))..))))).)}.))).,,(((((((....))))))),(((((.((((((((((.(((((..((((((,,({{(((..((((........(({{{{.........})))}}..,,,,.{{{||,.....(((......))).......})))).....)))).))))))))))....)).))))).)))))((((.((((.((((((((((...{(((((,.....(((((.((((({{|{,,...,}}},..,((((((((((.(((((.((((...))))))).)).))).)))))))...((((((..((((((,,(((((.({.,(((((((((((((((((.((.....((((.(((......(((((((,...,.))))))).......))).))))....))))))))).))))),((((.((((...(((((.((((((((((.(({...{{{{{{.,{,,,,.,,..|}|}}}.,..,....))).,,))))),,)))).))(((((((((((..(((...((((..(((((({(((((..((((((.......)))},)){(((((((((((((.(((((((((,.,,,......,{(((((((..{{,{((({((((((((((((((((((..((,..{,...))...))))))))),..,,,((.{((.((,.(({((({((((,,.....((((((((((((.............................))).))))).)))),,,,,)},}((((((.....(((((..((((((((.{(((({...}))))).))}.........,)))))..}))))....))))))..}))}}}}..}}.))))),((((......))))...(((.....))){(((({...(((((((...((((((.(((.(......).))))))))).....))))))){{{(((((....)))))...}}}......(((((...((((((..(((({((({(..{{,,.(((((((...}))))))....,,.))}}}},.......((((((.(((((({....(({.((.((((....((((((...)))))}((((((((((((....)))))........{{{,(({((({{{{{{(((((((((.{.....{{{....))).((((((((((({({{(((....}|||||,((((((((((((...))))))))))))..,}.||||((,,,||||||((((((,{,....,}))))))...{{||||||}|||.....((((((((((,((.(((.....}),})).))).))))))){(((((.......)))))}....(((((((..(((((.(((.......,.))})))))...))))))).,...,(((((..(((((((.(((((....))))))))))))..))))),.(((((((,.(((((((,..,,{((((((...(((((((({{{{.((,...}}})}},,,,)))))))).))))))}.}}..{((.(((((((((....((((((((((..(((((({.(((((.((.........,)).))))),))))))))))).........))))).}))))))))).)))........,.))))))).)))))))(((((((....))))))).}}}}}}}}}},.,,,},,)}))))))))))),.))))))))){{((((((({..((((.......((((((((((..(((...{({......))}..))).))))))))))........)))),})))))))}|..,,}}}}},,,})}))),,,,.))))))).(((((((.((((((((((((((({{((.,.(((......)))..,.))))))))))),.,))))))..))).)))).......)))).)).})).})))))).)))))).........||||....})),})))..))))))...))))){{((((((((..{(,.......}}..})))))))}}......,,.,||,,.....)))))}...})))))))))|,,,||}},}),,,))}}|||||({,({((((((,{((((..{((,,.{{|.|,,,..},)),},})))},,)))}}.}))))))),}|,,,,,}}...,}...,))))))))......)))))))))))))}....{(((({{,{(((((((((....))))))))))}})))))...)))))))))))..)))).|,.(((....))).|,.((((((,(((.((((,...,))))..))))))))))))..)))))..))))))..(((((((((...,{(.....,})...))).))))))...................))).)))).))))})))).,|||{,(((,....|||,,.}},.}))),},.})).))))},.))))))...)))))).,|,((.(((((((......)))))))}}.,}},...,)))).))))}((((((((...))))))))....((((((((((((((....,}))))))))))))}}||{(((((({(,(............((((((((.(((((((((((((((((...((.,.(((((((....(((((((...((((((.(((...)))..(((((.....)))))....{(,(((((,..(((((,,((({{{{{.||||{|||||,..{{{{..|||,,||||,,..,,,|(((((((....{{,{{{......((((((,.......,}....)))))).,,.,.))).)}..)))),,)}.}}})}}))).}}),)))})))))))}},,,...}},.)))))).)))))))......((((((((.((.(((......))).)),.))))))))((((((((((.,{{{{(..(((((..((.......,..))..))))),,|...{((((((((((.(((((((((((((,(((({.,,,||||......,.}}||||||}..,,,,,)))),)}...))))))))).....{({{,...}})}}{((.((((((((((..........(((((((.(((((({....(((...(((((((((((((....)))))))(((((....}}}))}},.......,.((.((((((,..(((((((((((((.((,.{(({.,(((((({...)))}.,))))))))).))))))))))))).........,((((.(..(((.((((.{{({,.........(((..((({.(((((((((........)))))))))).})))..))).(((((((((((..,{...(((((((...,,....,{{{.,.,{||||,,|||{,,({{|...||{||.||||{(((((((.(((((.....{{.,((((.....)))))}.....))))))))))))|((({{,...,||||))})))})}}}}},.....)))))))...,,..))).))))))))((((({{({(((....}}..,)))},,))}}},.{((((((...(((((.....,,,....(((...{(.(((({{{.{(((.((((((((((......,..((((......(((((((....((((((((,{(,....}})}.))))))))...,{,,,,...(((((((((.((((((..,(({,......,,,|)))))))))))))))..,.,,,,|{{||,,.})))),.,,,||||{.{{.{(((((((((((..(((({...,((((((((.....)))).......))))))))))))))))).)))}.))))))|((((((.(((((,........}.}..))))).))))))})))))))))))........))))))).))).))))..,,,((((((((((........))))))))))||{{{...})))))}},,)).)}...)))||||,....,..,.,,)))))(((((((((..(((((((,{{{{...}}}}.....(((((..(((((((.{((,.(,...,,(({.{.(((((((((((,.(((((((((((((((((((...(((((.(((((((((((((.{(({,{{,..(((((((((((((((.((((((((,{,,,{{{{{.....{{{,....,,{{{{,{{,,{,,{||,{{{{{,..{{(((((((((((((((((((({{(((....,,,.{(((({,,,.,,||||||,,.((((((..(((((((((....,.((({(((,{{(((((((((..{,{{{|,,,,}}},)).))))))).))......,}}})))....((((((.....,.)))))).((((((((...((((....))))...)))))))).{((..((..(((((((((((((((((((((((....{(((,{,,,||.,})}{(|{{{{.{((((({,.,{{.(({...,,(((({,,|{{{((((..(((,..,{,,.,.,},}.}}}..}}}}},|||,,...,,||{(({{((,.,,{{{{{,...,||,.,,,||||||,,{(((...)))}|||,,}.{..{((((({....})))))}..,...,,.,,,}|,||}}}},,,,}}}}.,,...},}}}}}))}|||,.}}}}|,,.|||,..,,},,,......})}},,.......))))),,,,.})),}}}}}}})))}}|}}}|||....((((((({..{((({||(.{((..........,...))).))))))))))))))).)))},)))).....)))))))))).....)))))..))..))}....{(((.{(.(((((,,.,{{{........))}.,.))))).}}.)}}}.,{(((,(({....))).))))})))))))))..)))))).........,.|||}||{||||||{(,,,{{,({.....,,}).,,,,.||}}}}))))}|||({{(({{((((({.{{,{{|}}}|||||.{{(((({(,,,,,,.||||,.|}}|}|..|||||{{{{{}}}}}}.||||||.,,{|},,|||{((.(((((((.(..,.{{(,{.....,,...)))....).))))))).))||||...(((((((.,{.{(((,....,}}.}})),..)))))))...||||,|||||{{|||||,,{{{{{{|,|(((((((((((.(((.....))).))))..}).)))))}|||(((({(((((.|{||{((||,.(({({(,((({{(({.,,{{((..,{{.(((..{{{{||||||,{||{{{{..|||||}|{||||,,,,((({....,}}}}.,,,,,,||||}|||||||.{{|||||{}}.,.,,|||||,...(((((,....}))))).,}}.)))|||||{{{{{|(|{{{((((((({((({,.,.|{{{||,,,||,...((((((.......)))))}................((((((((,.((({....)))).,)))))))).{(((((((((((((((({((..((((((...((((((...(((((..(((((((.({.......))..)))))))))))).))))))...,..)))))}..)))))))))),.........................,.,{((..(((((((({,.....,|,.....}))))))).....))))},,}}||.,,|||||,}|||{,,{,|||,..{{((((.......)))).,,{({{,({..{{{||||,(((((((....))))))).....}}}}.,|||},||}},},.,|,..|||{{{{{{,{{,{{{.|||||{|{{.,,,|}|||||,,,{|||{|.,||||....}|}}|}}}},..,)))}}))}.{{{{{{.|,.,,,,,.},))}))),|||,.,||,}}}}...}}|}}}}},.,,,,,.......|||}.}})}||{,,{{{||,||.((((((.,,,|||||,.{{{|||,,,,.,)))))}})}}}}},)))),..,,}})))))))))).)}))}}}}}}}},,,,,,,,..,,,|{{{{...{{{,..{{||{{{||{|....,}}}.)))))}})),)))),...{|{{{|||||,,||||||{,{|}||,,..,|(((((((((((((((((((((((....))))))))))))))))))))))).}}.}|}}})}})}))||....((((((({.{(((...((((((((.((...((((((.((((((.,..........((((((((((((((((.(((.((..((.((({.....((((.(((((.((((.(((((((...((,(({.((((((,,,...(((((((.{(((...))}}})))))))((({({(((({({.,.(((((((((.{({{,..,({{.{,,,,..},}}}..,)}}..,||,,..))}......,})))),}))))..))}.)))))))))....}}}....))))))..))).)}.)))))))((((.{(((((({(((({......}))))..}))))))}.)))).({({...,)}}.)))).)).))).)))),.})))),.)),..))).))))))))))))))))((((({..({(((((..(((........)))..)))))..}}...))))))...})))))).))))))...))))))))))...))))})))))))........||||}},.||,,,||}||.}}}}..,,.,.......,,,,,.,,}}}},,}}}})}}},,,))))))}.,,))))))}}}}))},.,.,,..,,}}}}..,|||},}}||,......,}}}}}}}}}}}}..{{{{,{{{{(((....,,,,|,,.,,,})))),...}}}}},}}}}|||||}},}}})}))}}}}|{{(((((,{{||||{{{{{{((|.....{((((.,(((((((((((...{(((......)))|(((......))),.......))))...))))))).,))))|{{{..,)))).,|||,,,{{,|||||.||{||||,|||,,,..,))},}}.,,))),)})))}))}||||((((..((,{{{{{|||{{||}|(({(({{{{.,{{{,,....,.)))}}}))))}))}}}}}})))),,.....,,,}))))))).)}})))))},)}..}}}})})})))}})))))).(((.((((((((.({....)))))))))).))))))))))).))..(((((((((((.(((((((......))))).}},,.))))))})})))..))))))))|.,)}}}}}}{((((({{((((((,((..((((((((((((((.,.((((((((((((....)))....))))))))).{{(({...,}}}},,))))))),)})))))....||.|}},||||.......,|,,}}})}},))),,)))))}||,|||||||.....|||,.}},},)),.{((((((({({,{,((((.((((({,((....))))))))))))...}},,,}.}))))))))...}))).))))))....))))))).)))))..)))))))).)))))....)))),,))))))}})))))}})),....,,)})},))))))).,))))}((((((.((......)).)))))),{..(((((({{((((((((.(((((....((.(((((.(..((((((......))))))..).))))).))...)))).).))...)))))),}...))))))..)))))))))..)))))))))..)))))))..))).).)))).)))..)))))))))))))).(((((((((((.((((..((((.......))))...)))))))))).))))).((((((((((.(((...{{{.(({...,),)}}..,((((..(((((((...))))))).))))}))).)))))).))))................))))))...)))....})))))).........(((((((((((((((....))))).)))))))))).........(((((((.((((((,..((((.(((((..(((......))).))))).))))..}......)))))).)))))))...((((((((..,,.((({................,..))))....)))))))).))))))))))))))))).)))}}},....))))))))))((((.((((....))))..)))).))))))).,.))...)))))},)....))),,))))))..))))))))...))))))))))})))),...))),...(((((((.((((...)))).)))).))).,,..,))))))..)))).)))))))))..))))))))))))))..{{{((((((((((((,{((((((.((((.(((((.{(((......))).,..))))).)))){(((((((((((((..((((.(((((.{{(((.....,).))))))))))))..)}))))))))))))}{.(((((....))))).,.)))))))))).....)))))))))..}}|,{.(((((((.(((((((.((((((.............)))))......((((((....((((((((((({((((((((((((((.,,,,{((.(((((......((((((((((...(((((.(......).)))))...)))..)))))))......))))).,)),}..)))})........))))))))){(((((.....(((((((({{(((,..,|}|}|{{{(((,,,,{{..|,,|.(((((....})))).}.}}})))},||||||||,,.}}}|||||}......,,,,.,........,,.((..((((........)))).,.)),,...{{{{{,,,....}}}}}))),,)))).,.}))))}..((((((((.,,{....}}}))))))))....{((((((((((.....))))))))))}.(((.(((.........))))))...............,{{(((((((...))))))),}},......{{{.,,.(((((((((..((((..(((((({{{{.{{,,{....,,.,))),}}.,,)},..............)))))..))))..)))))))))..})))))))).)))))..)))))).).)))))))......))))))).}}............{(((((.|((.(((.(((((((((((((.....(,.(((((((((((.....((((...{{(..(((((....)))))..,.,,|))))...,,})))))))))).,,,|,||,|}}}}},,)))))),..,,....)))))))))))))...))).))....))))))...))))....)))))))).))........))))).))))).)))(((((......))))}..,,,,,,..,,,...},,)))....(((((......)))))..{{..((((((((.,.,,{,.(((...........}))..,,,}},...)))))))).},.))))))))....))))).,))),|(((((.((((.((((.(((((.........((((..((......)}.....)))))))))..)))))))).)))))|((((.((.{(((((.....{{.....}}.....(((,,((.{(,((((((((...)))))))).)},)))))).....((((((((....((..(((((((.....)})}))))...)).....))))))))..)))))}.)).))))}))))))....,{{{.....}}},.

Transcripts

ID Sequence Length GC content
GUUUUCGCCUCUCAGUUGCAGCAGAGAAGCCCCUGGCACCCGACUCUAU… 10749 nt 0.4322
Summary

The neuropeptide galanin elicits a range of biological effects by interaction with specific G-protein-coupled receptors. Galanin receptors are seven-transmembrane proteins shown to activate a variety of intracellular second-messenger pathways. GALR1 inhibits adenylyl cyclase via a G protein of the Gi/Go family. GALR1 is widely expressed in the brain and spinal cord, as well as in peripheral sites such as the small intestine and heart. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the GALR1 was significantly downregulated (0.05-fold) in injured dorsal root ganglia following spinal nerve ligation, a model for neuropathic pain [Wu et al. DOI:10.1177/1744806916629048]. In a rat model of alcohol addiction and withdrawal, the GALR1 exhibited region-specific expression changes, being decreased in the prefrontal cortex during alcohol dependence but significantly increased in the hippocampus and corpus striatum during both dependence and withdrawal, as validated by qRT-PCR [Sinirlioglu et al. DOI:10.14715/Cmb/2017.63.2.7].