Basic Information

Symbol
GAPDHS
RNA class
mRNA
Alias
Glyceraldehyde-3-Phosphate Dehydrogenase, Spermatogenic GAPDH-2 GAPD2 GAPDS Spermatogenic Cell-Specific Glyceraldehyde 3-Phosphate Dehydrogenase 2 Glyceraldehyde-3-Phosphate Dehydrogenase, Testis-Specific Spermatogenic Glyceraldehyde-3-Phosphate Dehydrogenase EC 1.2.1.12 Epididymis Secretory Protein Li 278 HEL-S-278 EC 1.2.1 HSD-35 GAPDH2
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_014364.5
Sequence length
1448.0 nt
GC content
0.5829

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-547.40 kcal/mol
Thermodynamic ensemble
Free energy: -576.08 kcal/mol
Frequency: 0.0000
Diversity: 289.05
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((.((((((((..(((((......(((.((((......((((.((......))...)))).....(((((.((((((.....)))))).).))))....)))).)))(((((((((...))).)))))))))))..)))).)))).))............(((((((..(((((..((...))..)))))....((((((((((((...((((((((((.......((.......))........)))))...(((.(((((....((((....)).)).....)))))..)))..)))))))))))).))..)))...(((((.(((((((.(((((((((.((..(((((.(((((((...(((((...(.(((....(((((((...)))))))..))))..))))).....((((((((((..((..(((((((((.(((..........((((..(((((......((..((((((.....((((((....))))))......))))))))...((.....))))..)))..)))).(((.(((((......)))))))))))))))))))).)))))))))))).))))))).))))).))...))))))((((((.((.(((((...(((((((.(((.....(((.((.....)).)))..((((((((((((.((((((((.......))))....)))))))).....))))))))))).).))))))...)))))........((((((.......))))))....(((((...(..((((((.(((((..((((.((..(((....))))).)))).)))))...)))))).)...)))))((((((.((...)).)))))))))))))))))(((((((((.((.........((.(((((((....))))))).))..((((((.(((..((((((((..((((........))))....))))))))..((((((.......))))))..(((.((((((..((((((..((((((((.((..((((((.(((((......((.....)).((((((.......)))))).)))))..)).))))((((....))))..(((((((((...((((.........)))))))))))))........(((........))).))..))).))))).((.(((..((((.....))))..))).))..))).))))))))))))....))).))))))..(((((((...(((((.(.(((.(((.((((.......)))).)))...)))).)))))...((((((((((((.(((((((((((.(((((...........))))).)).))))))..))).))))))))))))))))))))).)))))))))..))))))).)))))................)).)))))..
Thermodynamic Ensemble Prediction
.((.((((((((..((((({..,.{((({((...{{{((,(((..,{{,,..||,...,,,.....(((({,((((((.....)))))).).)))).....,},.}}))}|||,,,|}}}))).),,,)}}))))..)))).)))).))............{((((({..(((((..({...})..)))))....(((((((((((,.,(((((((((((.......((.......))........)))))...{((,(((((....{{,(,...,,.)).}...)))))..)))..)))))))))))).))..}))...(((((.(((((((.(((((((((.{,{{(((((.(((((({.,,(((((..,{.(((.,..(((((((...))))))),.))))..))))).....{(((((((({..((..(((((((((((((.,,....{,.((((.,({({{..,{{,{,..|{{{{{,,,{{((((((....)))))},,,...}))))))),,}|,....,||}}..,)}..)))).)),.{||||...,,,}}}))),.)))))))))))).))}))))))))))))))))).))))).))...))))))((((((.((,(((((...{((((((,({{...,,{|{|({.....)),|||.,((((((((((((.((((((((.......))))....)))))))).....)))))))),)},),.})))),,.)))}}......,.{(((((.......))))))....(((((...(..((((((.(((((..((({.((..(({....)))}).}))).)))))...)))))).}...))))}((((((.{{...)).))))))}})))))))))(((((((((.((.........((.(((((((....))))))).))..((((((.(((..((((((((..(((({.....}.))))....))))))))..((((((.......))))))..{((.((((((..((((((..((((((((.({{{((((,(,((({{......((.....)).((((((.......)))))).,)))),.,,.)))))||(....||,...(((((((({.,{({{(({....,}})}))))))))))).....,..{((........})),),..)))}})))).{(.(((..((((.....))))..))).)}..))).)))))))))}),....))).))))))..(((((((...((((({({(((.(((.(((((....},)))).)))...,))),|))))...{(((((((((((.(((((((((((.(((((...........))))).)).)))))),.))).)))))))))))}))))))))).)))))))))..))))))).))))).}}}............}).))))}..

Transcripts

ID Sequence Length GC content
AGCCCUGGCGCUCCGCACGCACCUCGGUAACAUCACAGCAGGUCCAGGC… 1448 nt 0.5829
Summary

This gene encodes a protein belonging to the glyceraldehyde-3-phosphate dehydrogenase family of enzymes that play an important role in carbohydrate metabolism. Like its somatic cell counterpart, this sperm-specific enzyme functions in a nicotinamide adenine dinucleotide-dependent manner to remove hydrogen and add phosphate to glyceraldehyde 3-phosphate to form 1,3-diphosphoglycerate. During spermiogenesis, this enzyme may play an important role in regulating the switch between different energy-producing pathways, and it is required for sperm motility and male fertility. [provided by RefSeq, Jul 2008]

Forensic Context

A study in rats demonstrated that the GAPDHS transcript levels in spleen tissue decreased rapidly in a reciprocal pattern at 25°C and an exponential pattern at 4°C when normalized to microRNAs, making it suitable for estimating early postmortem interval with low validation error rates [Lv et al. DOI:10.1111/1556-4029.12447]. A systematic review further confirmed the GAPDHS shows progressive degradation as PMI increases and is useful in determining early PMI, with mathematical models improving estimation accuracy [Cianci et al. DOI:10.3390/ijms25179207].