| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCCCUGGCGCUCCGCACGCACCUCGGUAACAUCACAGCAGGUCCAGGC… | 1448 nt | 0.5829 |
This gene encodes a protein belonging to the glyceraldehyde-3-phosphate dehydrogenase family of enzymes that play an important role in carbohydrate metabolism. Like its somatic cell counterpart, this sperm-specific enzyme functions in a nicotinamide adenine dinucleotide-dependent manner to remove hydrogen and add phosphate to glyceraldehyde 3-phosphate to form 1,3-diphosphoglycerate. During spermiogenesis, this enzyme may play an important role in regulating the switch between different energy-producing pathways, and it is required for sperm motility and male fertility. [provided by RefSeq, Jul 2008]
A study in rats demonstrated that the GAPDHS transcript levels in spleen tissue decreased rapidly in a reciprocal pattern at 25°C and an exponential pattern at 4°C when normalized to microRNAs, making it suitable for estimating early postmortem interval with low validation error rates [Lv et al. DOI:10.1111/1556-4029.12447]. A systematic review further confirmed the GAPDHS shows progressive degradation as PMI increases and is useful in determining early PMI, with mathematical models improving estimation accuracy [Cianci et al. DOI:10.3390/ijms25179207].