| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGACCUGAGAGGCACCAGGCCCAGCCGUGGCACCACACACCUCCCAG… | 465 nt | 0.5892 |
Gastrin is a hormone whose main function is to stimulate secretion of hydrochloric acid by the gastric mucosa, which results in gastrin formation inhibition. This hormone also acts as a mitogenic factor for gastrointestinal epithelial cells. Gastrin has two biologically active peptide forms, G34 and G17. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that serum levels of the GAST did not change after 6 or 12 Gy X-ray irradiation to the stomach, in contrast to increased levels of pepsinogen A and pepsinogen C, indicating its stability in this model of radiation-induced gastric injury [Chen et al. DOI:10.1177/1559325819886766].