Basic Information

Symbol
GATA1
RNA class
mRNA
Alias
GATA Binding Protein 1 GATA-1 ERYF1 NF-E1 NFE1 GF1 Erythroid Transcription Factor Globin Transcription Factor 1 Nuclear Factor, Erythroid 1 NF-E1 DNA-Binding Protein GATA-Binding Factor 1 GF-1 GATA-Binding Protein 1 (Globin Transcription Factor 1) Erythroid Transcription Factor 1 Transcription Factor GATA1 CNSHA9 HAEADA XLANP XLTDA Eryf1 XLTT
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_002049.4
Sequence length
1464.0 nt
GC content
0.6059

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-593.10 kcal/mol
Thermodynamic ensemble
Free energy: -619.09 kcal/mol
Frequency: 0.0000
Diversity: 358.66
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((.(((.(((..........))))))))((((....((........))...))))......((((((((...((((((((...((((.(((((.(((((((.((.((((((((((((..(((((.((((...(((((((((.((((((....(((((....((((.......)))))))))....))))))))))).))))((((((((((((.((((.(.(((.((((....))))..)))).)))).)))........))))).))))(.((((..((((........))))...)))).)..)))).....)))))...)))))))...(((((((((.(((((((.(((((((((.(((.((((.....(((((........)))))..((((((.((((.(((((..((..(((((.((.((((.(((((..(.(((((..((((((((.(((....))).)))((((....(((((.(((.((((.....(((((...........)))))..)))).))).)))))...))))..(((((((..........))))))).......)))))(((((((......(((((...)))))............((..((((..((((.((((..(((((((((.((.(.(.(((((((((.....)))).))))).).).))...)))))))))....(((((......)))))...)))).)))).))))..))......(((.....)))((((..........(((((..((((.......)))).))))).))))........(((((.(((....))).))))))))))))((((......)))))))))...)..))))).).))).)).)))))....)).)))))..((((...(.((((((((((((..((.................(((......))).((((((((.(....).))))...))))....))..)))).)))))).)).)...))))..........((((....)))))))).)))))).....)))).))).))))))))).......((.((((((..(((((((((....))(((..((((((((((((((((.(((((((((((..(.(((...((((....(((((..(((....)))..))))))))).))).)))))).))))))..)))))))))............(((.(((...((((....)))).))).)))...)))))))..))).)))))))..)))))).))....))))))))))))((((.((((....))))...)))).((((..(.((((((((((.(....))))))))))).)..)))).....))))...........)))))))))))))).)))))..)))).))).))))).))))))))...........................
Thermodynamic Ensemble Prediction
...,{(.(({{(((..........)))||}.,,.,{,,,.||........}}..,|||,......((((((((...((((((((...((((.(((((.(((((((.((.((((((((((((..(((({.({((,.,{{{.((((((((.....))))))))...{((((.......))))),{||{{{{||||||||({,.((,|,{||.||||{{{,|||{,||{((.{{(({,..||||{.,,,)}))),.)))}.......,}}}|,|))||||}|,..{(((........)))),,})))},}.,)),..}}..}))))...)))))))...{{{{(((((.(((((((.(((((((((.(((.((((.....((((,....}}}|)}}||..((((((.((((({(,{.(((((...)))))....}},.((((.(((...((,(((((((({,(((....))}.}}}((((....(((((.(((.((((.....(((((...........)))))..)))).))).)))))...))))..(((((({,{{.....}}))))))).,,,.}}))))))...}}.,,...))).)))).}((((((((.,,.....,(..((((..((((.((((..(((((((((.((.(.(,(((((((((.....))))},)))).).).))...)))))))))....(((((......)))))...)))).)))).))))..,,.,,,.,,|,..((((({{({{(,,,,,....||||{..||||....,,,))||,|}}||,((({...,...{(((((.{(((.{{{{...|{(({{(({....{({({(..{(((.((.....((.(((({....})))).)).....)).))))(((...}))}})))),.|||||||,{,,|,}}}}}},,.......}}))))....)))).((((((((.(....).)))),..})))....)}..))))},))),,.}),)..}))).....,,...))))))))....))))).)))))),,,..)))).))).))))))))),,,....{({((((((..(((((((((....))(((..((((((((((((((((.(((((((((((..{,((,{{.((((....(((((..(({....)))..))))))))).)),})))))))))))))..)))))))),............(((.(((...((((....)))).))).)))..})))))))..))).)))))))}})))))),),....))))))))))))((((.((((....))))...)))).((((..(.((((((((((.,....))))))))))).)..)))).....}}||.....}},...)))))))))))))).)))))..)))).))),,)))).))))))))..................,,.......

Transcripts

ID Sequence Length GC content
ACACUGAGCUUGCCACAUCCCCAAGGCGGCCGAACCCUCCGCAACCACC… 1464 nt 0.6059
Summary

This gene encodes a protein which belongs to the GATA family of transcription factors. The protein plays an important role in erythroid development by regulating the switch of fetal hemoglobin to adult hemoglobin. Mutations in this gene have been associated with X-linked dyserythropoietic anemia and thrombocytopenia. [provided by RefSeq, Jul 2008] CIViC Summary for GATA1 Gene

Forensic Context

A study in mice demonstrated that the transcription factor GATA1 regulates erythroid-specific genes in embryonic (EryP) cells predominantly through promoter-centric mechanisms, while in adult (EryD) cells it increasingly relies on distal enhancers for gene regulation, with Gata1 HiChIP confirming significantly increased enhancer-promoter interactions for EryD-specific genes [Cai et al. DOI:10.73/pnas.2008672117]. A study in mice demonstrated that ionizing radiation (6.5 Gy) induced differential expression of numerous genes in bone marrow cells at 6 hours, where the GATA1 mRNA was down-regulated by 0.35-fold [Dai et al. DOI:10.1080/09553000600857389].