| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACUGAGCUUGCCACAUCCCCAAGGCGGCCGAACCCUCCGCAACCACC… | 1464 nt | 0.6059 |
This gene encodes a protein which belongs to the GATA family of transcription factors. The protein plays an important role in erythroid development by regulating the switch of fetal hemoglobin to adult hemoglobin. Mutations in this gene have been associated with X-linked dyserythropoietic anemia and thrombocytopenia. [provided by RefSeq, Jul 2008] CIViC Summary for GATA1 Gene
A study in mice demonstrated that the transcription factor GATA1 regulates erythroid-specific genes in embryonic (EryP) cells predominantly through promoter-centric mechanisms, while in adult (EryD) cells it increasingly relies on distal enhancers for gene regulation, with Gata1 HiChIP confirming significantly increased enhancer-promoter interactions for EryD-specific genes [Cai et al. DOI:10.73/pnas.2008672117]. A study in mice demonstrated that ionizing radiation (6.5 Gy) induced differential expression of numerous genes in bone marrow cells at 6 hours, where the GATA1 mRNA was down-regulated by 0.35-fold [Dai et al. DOI:10.1080/09553000600857389].