| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUGGGUCAAGCACAGCCCUGAGCGGCCGCGUGUCCGAGGCCCAGGUGC… | 3470 nt | 0.5986 | |
| GAGUCGGCAGCUGGCGCCAGGGCGGCCGGAGGAUGCCGAGGGGCCGGAG… | 3263 nt | 0.5927 | |
| GAGAGAGAGGCAGCGUGAGCGCCAGGAAGGUAGCGAGGCCAGCGUCGCC… | 3383 nt | 0.5974 |
This gene encodes a member of the GATA family of zinc-finger transcription factors that are named for the consensus nucleotide sequence they bind in the promoter regions of target genes. The encoded protein plays an essential role in regulating transcription of genes involved in the development and proliferation of hematopoietic and endocrine cell lineages. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009] CIViC Summary for GATA2 Gene GATA2 is a transcription factor involved in stem cell maintenance with key roles in hematopoietic development. GATA2 mutations are associated with a variety of inherited and acquired immune disorders including myelodysplastic syndrome and acute myeloid leukemia. In addition to a role in hematopoiesis, the maintenance GATA2 expression has been implicated as a requirement in KRAS-driven non-small cell lung cancer. Preclinical models have indicated therapeutic benefit from targeting GATA2-mediated pathways in the context of KRAS-driven NSCLC.
A study in humans using single-cell and bulk RNA sequencing identified the GATA2 as a predicted transcriptional regulator of key hub proteins in cardiomyopathy, where it is linked to the disease and suppresses cardiac development of human mesoderm [Rahman et al. DOI:10.1038/s41598-024-78011-3]. Validation via receiver operating characteristic curve analysis on independent datasets demonstrated an area under the curve of 0.737 for the GATA2, indicating its diagnostic performance. A study in domestic swine demonstrated that the GATA2 exhibited opposite regulation, being repressed in the border zone but induced in the ischemic zone of the heart following myocardial infarction [Kaikkonen et al. DOI:10.1161/CIRCGENETICS.117.001702].