| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGCCGGAGUAACGGGACUCCCAGCUGCGCGUCGCAGUCCCGACGCGA… | 727 nt | 0.6382 |
GTP cyclohydrolase I feedback regulatory protein binds to and mediates tetrahydrobiopterin inhibition of GTP cyclohydrolase I. The regulatory protein, GCHFR, consists of a homodimer. It is postulated that GCHFR may play a role in regulating phenylalanine metabolism in the liver and in the production of biogenic amine neurotransmitters and nitric oxide. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the GCHFR gene was upregulated in subcutaneous adipose tissue during short-term (0-5 month) weight loss in obese participants [Bollepalli et al. DOI:10.1038/ijo.2017.245].