Basic Information

Symbol
GDF10
RNA class
mRNA
Alias
Growth Differentiation Factor 10 BMP-3b Growth/Differentiation Factor 10 Bone Morphogenetic Protein 3B Bone-Inducing Protein BMP3B BIP GDF-10 BMP-3B
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_004962.5
Sequence length
2677.0 nt
GC content
0.6081

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1101.90 kcal/mol
Thermodynamic ensemble
Free energy: -1147.26 kcal/mol
Frequency: 0.0000
Diversity: 725.35
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......((((((.((((((((((((.(((((((((....))))....(((((.(((((........)))))..)))))((((((((.(((((((((..((.((....)).))..)).)))))))((.(((((((((((((.((.(((.(((......((((.(((((....).)))).))))......))).))))).)))))))))))))))(((((((.(((((.(((((((...((((((((((((((((((((((.((((((...((.(((((((...(((((...(((......)))....)))))))))))).))..)))).)).))).......))))))))))))..((((.((......)))))).))))))).)))))))))))).))...))))).........(((....)))...((((.....))))...............((((...((((......)))).)))).)))))))))))))..))))))).)).)))))).)))((((((((..((((.(((((((.......)))).))).)))).((((((.(((((.((((.(.(((((((((((....)))))((((...((((((.(((((((.(.(((...((((((.(.((((......)))).))))))).)))).)))...)))).))))))...))))..((((.(((.....))).)))).)).))))).))))))))).)))))).....((((((((((....((((..((((((((((((((.....)).((((((((((((((.....((..(......)..))....))))))).....))))))).....))))))))......)))))))).((((((((.(((((.((..(((.(...((.....))).)))..)).))))).)))))))).)))))....))))).((((((((..(((((.(((((((((((((((((((.((........)).....))))))).....)))))(((((((((...((((.......)))))))).))))).(((((.(((((((((((((.((.....((((((.((((.....)))).))))))(((((((...(((.......))).)))))))...((((((...)))))).((.((..((.((((((((.(((((..(((..(((((.((....((((......).)))......)))))))..)))...((((.((..........)).))))(((.....)))(((((((.(((((.............((((....)))).(((((......)))))((((....))))((....)).......)))))))))))))))))...((((((.(.(((....))).).))....(((((.((....)))))))..(((((((....))).)))).......)))))))))))).))...)).))..)).)))...)))))))))).)))))((((.((((....((((((((((.((((.((.((((((..(((((((((....(((((((((((((((..(((((..(((((((((((((....(((((...(((((.(((((.((((((..((.(((((.........(((((((((...............(((.((((((......))))))..)))..)))))..))))))))).)).))).)))...(((..((((((.(.(((((((.((((..(((....)))...)))).)))))))).))))))..))).............((((((((.(((((.......(((((((.....)))))))))))).).))))))).))))).)))))))))))))))).)))).)))..)))))..))((((......(((((...((((((.((((..((((((((.(((((.(..((((((.((.((((((((.((((.((((....((....(((.(((((..((....))..))))))))...)))))).).))))))))).(((((((((...(((((...)))))...)))))))))..)).)))))).))..).)))))..)))))))).)))).)))..)))...)))))))))..))))).))))))))))))..(..(((....)))..)..............)))))..))).))).)).))))..(((((((((..................(((((.(....).)))))...(((((......))))).....)))))))))..((((((((((.(((((...((.((((((.....)))))).)).))))).))...))))))))....)))))))))))))))).))........(((((.......)))))(((((....)))))........((((.(((.......))).))))...........(((((((.(....).)).)))))...)))).)))...))))).))))))))(((........)))....)))))))).....((((..(((((((((((..(((((((............)))))))((((..(((((..(((((...)))))..)))))..)))))))))))))))....))))........(((((((....)))))))......
Thermodynamic Ensemble Prediction
..,,,,(((((({.(((,,(((((((.(((((((((....)))),...(((((.(((((.,......)))))..)))))((((((((.(((((((((,.({.((....,}.))..})))))))))((.(((((((((((((.((.(((.(((......((((.(((((....).)))).))))......))).))))).)))))))))))))))(((((((.(((((.(((((((...((((((((((((((((((((((.((((((.,.((.(((((((...(((((...(((......)))....)))))))))))).)),.)))).)).))).......)))))))))))),.((((.((......)))))).))))))).)))))))))))).},}.,)))))..,,.....{((....)))...{|||.....)}}},.........,,...((((...((((......)))).)))).)))))))))))))..))))))).))}}|||||.{||{||{{{,{{{({((.(({((((,..{{{{||||.||}{||||{((((((.(((((.((((.{.(((((((((((....)))))((((...((((((.(((((((.(.(((...((((((.(.((((......)))).))))))).)))).)))...)))).))))))...))))..((((.(((.....))).)))).)).))))).))))))))).)))))).,,,,|||{,|||}|,,((((((({(({(((((((((,......|,.((((((({{{{(({.....{((,{,,....},,,)....))}}}}),....))))))).,},,)))))))),.,,.{{(({((,,,((((((((.(((((.((..(((,(...{{...,.})),))}..}}.})))).)))))}||{{{{((((((((({|,|.......{{{(({{{((((...,{.||||..,||.}},|,,,{|||||.,.|}}||||,...,,|||||||}.}|)))})}||||||,....},|,||||{||{({.(((((.(((((((((((((.{(.,,..((((((.((((,...,)))).)))))}(((((((...({{.......}}).)))))))}..((((((...)))))),|{.{{..{{.((((((((.(((((..(((..(((({,((...{((({......).))),,....)))))))..)))...((((.((..........)).))))(((.....)))(((((((.(((((.,.......{{{{(,((.{{.,|||{,(({,...}}})))},||||.}}}))}|{{....)).....}.)))))))))))))))))...((((((.(.(((....))).}.||....((((,{((....)))))))..(((((((....))).))))......})))))))))))).})...)).})..)}.)))...)))))))))).)))))))).,))))))))|||{((((({.{{{{.{,.{{{,,,..,{|||}}}.||..||||||||{{{{|||,,{{{{|.|(((((((((((((...,((({(..,{{(((.(((((.(({(((..((.((((((.{{{,...,{,.{{{....)}}{{........||{,((((((......))))))..,}}...})}}.}}))))})))})).))}.)))..{(((,,((((((.(.(((((((.((((..(({....}))...)))).)))))))).))))))..},,.,{{.{.,{{{{.,,|||||},}|||{,}}}}},(((((((.....)))))))}}}||,}.,}}}},,.})))).)))))))))))))))).)))).))).,)))))}.}|{(({......{((((...((((((.((((..((((((((.(((((.{..((((((.((.((((((({,{{({.{{{|...,((.,,,(((.(((((..((....))..)))))}}}.,,)))))).)},}))|||}},{((((((({,,.(((({...}))))..,))))))))}.,}}.}})))).))..}.)))))..)))))))).)))).))),,)))...)))))}}}}}.}})}}.)))}}||||||{..|}}||,....,,,..,....,{,,.....,}}.,||{||},,,),)),}}}}..{((((((((...,,,.........,,,|((((.{....).))))}...(((((......))))).....))))))))),,||((((({((.{{{{{...{{,((((((.....)))))}.,|.))))).)}.,,))))))}),,,,))))))))))}})},,(((((...((((((.{({{{(({,,{{{{((((....))))}.........,{,.,,,.......}}}.|||{{{((((.....(((({((.{....}.)).))))|((((....((({...))))..))))}))))))}..}}}}}}}}})},,,,,||{{{{{{||{{,.,.{({,.{{.,......,|..}}}.,,.,{{{{{.,,,))}}},.{((((..(((((...)))))..))))),.,)))))))}.,))))))))))).........{((((((....))))))),.....

Transcripts

ID Sequence Length GC content
ACACACGGGCGCACGCACACGGCAGCCGGGCCAGGGACGACCCUGUCAG… 2677 nt 0.6081
Summary

This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This promotes neural repair after stroke. Additionally, this protein may act as a tumor suppressor and reduced expression of this gene is associated with oral cancer. [provided by RefSeq, Jul 2016]

Forensic Context

A study in mice demonstrated that Gdf10 is a specific marker for stromal cells type 3 (ASC3) within brown adipose tissue, as identified through single-nucleus mRNA-sequencing [Behrens et al. DOI:10.1016/j.molmet.2025.102252]. A study in human HT-29 colorectal adenocarcinoma cells exposed to arsenic trioxide demonstrated that the GDF10 showed no significant change in protein expression as assessed by immunoblotting, indicating it was not involved in the endoplasmic reticulum stress response under those experimental conditions [Kazuta et al. DOI:10.1016/J.Legalmed.2026.102774].