| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCCCAGCUCAGAGCCGCAACCUGCACAGCCAUGCCCGGGCAAGAACU… | 1200 nt | 0.6292 |
This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The protein is expressed in a broad range of cell types, acts as a pleiotropic cytokine and is involved in the stress response program of cells after cellular injury. Increased protein levels are associated with disease states such as tissue hypoxia, inflammation, acute injury and oxidative stress. [provided by RefSeq, Aug 2016]
A review of proteomics in forensic science notes that the GDF15 shows a notable correlation with chronological age in human plasma, contributing to donor profiling for age estimation [Alex et al. DOI:10.1016/j.scijus.2025.101320]. A study in humans and mice identified the GDF15 as a predictive biomarker for heart failure following acute myocardial infarction, with its expression consistently upregulated in peripheral blood mononuclear cells of patients and in recruited monocytes/macrophages from mice [Chen et al. DOI:10.1186/s12920-021-00890-6]. A separate review of human multi-omics studies notes that the GDF15 is a top protein associated with aging in plasma proteomic analysis and is also a component of the GrimAge DNA methylation clock as a DNA methylation surrogate [Solovev et al. DOI:10.1016/j.mad.2019.111192].