Basic Information

Symbol
GDF15
RNA class
mRNA
Alias
Growth Differentiation Factor 15 MIC-1 NAG-1 PTGFB PLAB MIC1 PDF Prostate Differentiation Factor Non-Steroidal Anti-Inflammatory Drug-Activated Gene-1 Placental Bone Morphogenetic Protein Growth/Differentiation Factor 15 Macrophage Inhibitory Cytokine 1 NSAID-Activated Gene 1 Protein NSAID-Regulated Gene 1 Protein Placental TGF-Beta GDF-15 NRG-1 NSAID (Nonsteroidal Anti-Inflammatory Drug)-Activated Protein 1 Macrophage Inhibitory Cytokine-1 PTGF-Beta HG
Location (GRCh38)
Forensic tag(s)
Chronological age estimation Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_004864.4
Sequence length
1200.0 nt
GC content
0.6292

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-497.10 kcal/mol
Thermodynamic ensemble
Free energy: -517.76 kcal/mol
Frequency: 0.0000
Diversity: 412.05
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((.(((((...(((...))).((((.((((((((((..((.....((((((((...(((........)))((((.((((((..(((((((.(((((.(((.(.(((.(((((((.((....(((.(((((..(((((....(((...((((..((((..(((.....((((..(((((..(....)..))))).))))...)))..)))).))))..)))..(((((((((.......(.(((((((.((.(((.....)))..)).)))))))))))))))))(((((.((((.(((........)))))))))))))))))....(((....))).....((((((..((((((....))))))..)))))))))))..)))...)).))))..((.((((((((....((((((((....(((((((........)))))))...((((((.((((.(((...((((.........(((....))))))).))).).))).)))))))))))))))))))))).))..(((.(((.((....))))).)))(((((.(((.((......)).))).)))))...))).))).).)))))))))))))))..))).))).))))...))))))))..))..)))))))))).))))(((((.(.((.((((((.((.(((.(((((((.....(((.((((((...((((((((.((((.((((.((((((.((.......((.(((.(((((((((((..((......)).))).......)))))))).)))))......)).)))))).))))...........)))).)))))))).....)).))))))).......(((((..((((.((..((....))..)))))))))))((((((((((....((((((((((((........((((((((.......)).))))))..(((((.(((.((((((....)))))).))).).)))).(((((((...((.....((((((((((((.......))))...))).))))).))....))))))).......))))))).)))))..............)))))))))))))).))).))).)).))))))))).)))))..((.(((.((((((............)))))).))).))...))))).)))..
Thermodynamic Ensemble Prediction
.....(((.(((((,(.((....|||,((((.((((((((((..((.,.,.((((((((..,(((({.(((..,,.((((((...((.(((,(((,{((((((((({{.,((({(({,,.,|||||},}}.,,))),,}}}))},..(((({{{(.(((.(((.(((((....((....}|.,,..})))).))).))).)))))))}},.,))),})).))..))))))|||,|||}},....{.(((((((.((.(((.....)))..)).))))))),}}}||||,{(((((.((((.(((........)))))))))))))}||}},,,,||,,}.)}},..,,{(((((..((((({....})))))..)))))}|{.....}}}}.,.}})}}}|,||,,,,||||((((((((((,(({...(((((((........))))))).{{|||{||||.({.,,,,...))....((((.(((((..((((((((..(((((((.(.((.{..(((((.((.(.((((....(((....)))....)))).).)))))))..}.)).).)))))))..)))))}}))..),}))).))))||||}||}},{{|||.||||||,.||}||},}}}}))))|.}|,.))))))))}}.||}|(((((.(.((.{(((((,((,(((.(((((((..{{{(((,((((((...((((((((.((((.{{{{.{|||{{.{{..|,...{{.(((.(((((((({{{.{{{..,,.,})}))||......)))))))).))))},,,,}.)).})))}),))))..,,,,,,..,))}).)))})))),,.,,)),))))))}}},....,,(((.,((((.((..((....))..)))))))))))||{|||{(({,,..,{{{{({{{{{,.,{,....((((((((.......}).)))))).,(((((.(((.((((((....)))))).))).}.)))}.{{|||||,.|({,,...{{{{{||||{{,.{,,,,|||||...|||,|}}}}.}}.,,,||||||},,.....))}))})})))}........,,.....,)))))))}}}})))})),))),)),))))))))).)))))..,,,}||.{(((((,....,......}},,,},})},,)).,))))).)))..

Transcripts

ID Sequence Length GC content
AGUCCCAGCUCAGAGCCGCAACCUGCACAGCCAUGCCCGGGCAAGAACU… 1200 nt 0.6292
Summary

This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The protein is expressed in a broad range of cell types, acts as a pleiotropic cytokine and is involved in the stress response program of cells after cellular injury. Increased protein levels are associated with disease states such as tissue hypoxia, inflammation, acute injury and oxidative stress. [provided by RefSeq, Aug 2016]

Forensic Context

A review of proteomics in forensic science notes that the GDF15 shows a notable correlation with chronological age in human plasma, contributing to donor profiling for age estimation [Alex et al. DOI:10.1016/j.scijus.2025.101320]. A study in humans and mice identified the GDF15 as a predictive biomarker for heart failure following acute myocardial infarction, with its expression consistently upregulated in peripheral blood mononuclear cells of patients and in recruited monocytes/macrophages from mice [Chen et al. DOI:10.1186/s12920-021-00890-6]. A separate review of human multi-omics studies notes that the GDF15 is a top protein associated with aging in plasma proteomic analysis and is also a component of the GrimAge DNA methylation clock as a DNA methylation surrogate [Solovev et al. DOI:10.1016/j.mad.2019.111192].