| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCUUUGGUCCAGUGCGGUGGCGGCGGCGGCGGUGGCGGCGGCGACUGC… | 2240 nt | 0.5576 |
GDP dissociation inhibitors are proteins that regulate the GDP-GTP exchange reaction of members of the rab family, small GTP-binding proteins of the ras superfamily, that are involved in vesicular trafficking of molecules between cellular organelles. GDIs slow the rate of dissociation of GDP from rab proteins and release GDP from membrane-bound rabs. GDI1 is expressed primarily in neural and sensory tissues. Mutations in GDI1 have been linked to X-linked nonspecific cognitive disability. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the GDI1 was up-regulated in brain tissue at 8 hours (1.903-fold) and 24 hours (1.961-fold) following whole-body irradiation with 10 Gy γ-rays [Zhao et al. DOI:10.1158/1078-0432.CCR-05-2418]. This finding was validated by real-time quantitative RT-PCR, which showed 100% concurrence with the microarray data in terms of the direction of change. A study in humans demonstrated that the GDI1 mRNA was up-regulated by 34% in pericontusional brain tissue from one traumatic brain injury (TBI) patient (T4) and by 56% in another (T7) compared to control tissue, as identified through cDNA microarray analysis [Michael et al. DOI:10.1016/j.jocn.2004.11.003]. This differential expression was part of a broader finding where 104 genes showed significant changes in traumatized tissue, with genes involved in signal transduction, like the GDI1, being among the functional categories most often affected.