Basic Information

Symbol
GFER
RNA class
mRNA
Alias
Growth Factor, Augmenter Of Liver Regeneration HERV1 ALR FAD-Linked Sulfhydryl Oxidase ALR ERV1 HPO1 HPO2 HSS Hepatic Regenerative Stimulation Substance HPO Growth Factor, Erv1 (S. Cerevisiae)-Like (Augmenter Of Liver Regeneration) Augmenter Of Liver Regeneration ERV1 Homolog (S. Cerevisiae) Erv1-Like Growth Factor Hepatopoietin Protein Hepatopoietin ERV1 Homolog EC 1.8.3.2 MMCHD MPMCD
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_005262.3
Sequence length
2365.0 nt
GC content
0.6220

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1074.50 kcal/mol
Thermodynamic ensemble
Free energy: -1113.36 kcal/mol
Frequency: 0.0000
Diversity: 631.39
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((((((((((.(((((..(.....)..))))))))))(((((((((((((.(((((((((.......))))))))))))))))...)))))).......((.((.(((((.(......((((((((((((((((.(..(((......)))..)))))))))))))).)))...))))))))))..((((((((......))))..)))).((((((...))))))))).))))))).(((((((.((........)).)))))))..((((..(((((((((....((.(((((((((((((((((.((((.((.....)).))))...((....))..((((.((((((.((((((..((.....((((((..(((((((((.(((((..(((((((.((.....((((((((......((((((((..........((.(((((.((((((((((..((.(((.......)))))((((.((.............)).))))...)))))))))).))))).)).(((((.....)))))..)))))))).....))))))))((((((....((.((((((.....(((((((.(((.((((((((((.((((.((((((..((((((((((.((((((((.((((((((((.((((((....(((((((....)))))))....((((((((((((......)))))....(((((((.(((((((((.((((.((.((((((..((((((.....(((.(((((.((((((.((((.((..........)).))))..((((......)))).)))))).))))).))).((((((((..(((.....)))..)).((((((.....)))))).))))))..((.((.((((...(((((((..(((((...)))))..))))))).)))))).))......))))).)..)))).))..))..))))..))))))))))))))))((((((((((.((.(((...(((.((..((((....))))..)).))).)))))))))))))))))))))))))))))))))).)))).)))))...(((((......)))))......)))))))...))))))...((.(((((.(((.......((((((..............)))))).))).))))))).))).))).))))))))))))))))).)))))))..(((.(((....((.((((((((.....(((((.....))))).......))))))))))..))))))((((((((((.......))))))))))......)))))).))..))))))......(((((((((.(((((((.((..((((((((...((((((((((((...........(((....)))..))).))))))))).)))).))))...))...)))))))))))))))).(((.....))).....((((..((.(...(((....))).).))..)))).(((.(((..(((((((((.((((((((((((.(((((((((.(((((...))))).))))...))))).))))).)))....))))...)))))))))..))).))))).)))))))..))))).)).)))))))..))))))....)).)))))).)))))))))).)))))(((((...))))).....((.((((((.........(((.((((......((((((........((((((((.(.((((.(((.(((....((((((((((((..((((..(((((((.(((.((((.(.......).)))).)...((((....))))..((((((((((....(((......)))....))).))))).))...))..)))))))....((((.((...)).))))...))))..))).)))))))))))).))))))).).))))))))((((((((.(((.((.(((...((((......)))).))).)).)))..))))...))))(((((....(((((((.((.(((....((((((....)))))))))))..)))))))))))).............(((.((..((((((((((.((((.(((.(((((...(((((.((...((((((((...((((((...(((((((((.(((((((...)).))))).))))......)))))....))))))))))))))..))..))))).))))).))).).)))))))))))))..)).)))))))))...)))).)))........)))))))))))))))))))).))....))))).......))))...)))).......
Thermodynamic Ensemble Prediction
..(((((((((((({((.(((((..{.....|,,)||||}}}}}(((((((((((((.(((((((((.......)))))))))))))))),,,))})}}......,((.((.(((((,{.,....((((((((((((((((.{..(((......)))..}))))))))))))).)))..})))))))))),.((((((((......))))..)))).{(((((...))))))))).))))))),(((((((.((........)).)))))))..{{{{..(({((((({....{{.((((((((((((,{((({(,{{.,,}}}.}),.,|||{{.(({,..,,.|(({({({{{{{,||||||,,|{,}}},((((((..(((((((((.(((((..(((((((.(({...((({({{((({(..,{{{,.......,,.....{(,(((((.((((((((((..((.(((.......)))))((((.((.........,...)),)))).,,)))))))))).))))).)).(((((.....))))),})}}})),,},,...,,|((((((((((....((.((((((.....(((((({,({(,((((((((({{({((.(((((((((,,(({((((,{(((((((.((((((((((.((((({....(((((((....)))))))...{((((((((((((......)))))....(((((((.(((((((((.((((,({.(((((({(({{{||}}.{(({{((((((.((((.({((((.((..........)).))))..|.)|)))).))))))))))|},}|||||||..{{{{{{||,,|||...,,}},.,},,((((((.....))))))|||}|||.{(({((,({{({{.{((|{({.,|{{{{..,})))).,)))))}},}}||}}..,}},...))}))}}.})),))))}.....)))},.))))))))))))))))((((((((((.(,{(((...(((.((..((((....))))..)).))).)))))))))))))))))))))))))))))))))).)))).))))),,.(((({......,)))).,|,,|||,}}||{{.,},))}}.,||,{||{{.{{{....,}}||||||}}}..}}}}}}}}}.}},,,.,},.}}||(((,,,,.}}},))))))))))))))})),})))))).,(({.(((.{,({{,((((((({.,,|.((((|,....}..}).}},}.})))}))))}},.}}}))}((((((((((.......))))))))))......)))))).))..)))))))},}},,((((((((.(((((((,((,.((((((((...((((((((((((...........(((....)))..))).))))))))).)))),,))).,.})..,))))))}))))))))},|||,,,.,|},..,,.{{|{,,||.({,,(((....}}}.).,)}})))).{((,(((..(((((((((,((((((((((((.(((((((((.(((((...))))).))))...))))).))))).})}...}))))..,)))))))))..))),))))).)))))))..))))).)).)))))))..))))))....||,||||||,||}||,,}}}{||||||||.,.,,(((||,{({..{,((,,,,,,,.,,....((.(((({{{...((((,,........((((((((.{.(((,,(((.(({...,((((((((((((..((((,,(((((((,,{((({{({({{,{,,....}},.....((((....))))..({({(((((,....(((.{{{{,,,..}}})))))))).}))...}}..))))))).,.}||{{,||,,,)),)}},...))))..))),}))))))))))).))))))).).))))))))(((({{{{}|||.((.(((.,.((((......)))).))).)).))}..))))..}))})||,||....(((((((.{(.(((..,,((({{{....)})))))))}}..)))))))))))),}}........,.((((((..(((((((((,,((((.(((.(((((...(((((.((...((((((((...((((((...(((((((((.((((({{...}).))))).))))......)))))....))))))))))))))..))..))))).))))).))).).)))))))))))))..)).)))),))))))}))))})),))}})}..........)))))))))}}}.)},,,.))))),......})))...}))).......

Transcripts

ID Sequence Length GC content
GACCCGGCAGGCCUUGCGCGGGCAACAUGGCGGCGCCCGGCGAGCGGGG… 2365 nt 0.6220
Summary

The hepatotrophic factor designated augmenter of liver regeneration (ALR) is thought to be one of the factors responsible for the extraordinary regenerative capacity of mammalian liver. It has also been called hepatic regenerative stimulation substance (HSS). The gene resides on chromosome 16 in the interval containing the locus for polycystic kidney disease (PKD1). The putative gene product is 42% similar to the scERV1 protein of yeast. The yeast scERV1 gene had been found to be essential for oxidative phosphorylation, the maintenance of mitochondrial genomes, and the cell division cycle. The human gene is both the structural and functional homolog of the yeast scERV1 gene. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the GFER as a hub gene in the sky-blue module related to energy metabolism within the platelet transcriptome of patients with non-ST-segment elevation myocardial infarction (NSTEMI) [Zhang et al. DOI:PMC8129354].