Basic Information

Symbol
GHR
RNA class
mRNA
Alias
Growth Hormone Receptor GHBP Growth Hormone Binding Protein Somatotropin Receptor GH Receptor Mutant Growth Hormone Receptor Serum Binding Protein GHIP
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_000163.5
Sequence length
4899.0 nt
GC content
0.4256

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1390.40 kcal/mol
Thermodynamic ensemble
Free energy: -1483.58 kcal/mol
Frequency: 0.0000
Diversity: 1334.83
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((.((((...........))))))))((((((((((((........))))((((........))))..(((((((((((.(((((.....))).))(((((....))))))))...........((((((((((.(((((.((((..(((((...(((((((..(((((..(((.(.((.(((......(((....(((((..........)))))...)))....))))).)))).))))).)).)))))..(((((.((((((((((.(.(((.(.((((((..........)).)))))))).).))))..))))))))))))))))..)))).))))).))))).)))))((((((((((((((...((.((....)).)))))))))))))))).))))))))...))))))))....(.((((((((((...(((((((.....))))).))..)))))))))).)(((((((....)))).)))..((((((((((...((.(((((((((.........)))))))))))(((((((((.(.(((...((((..(((((..((((...)))).)))))..)))))))).))))))))).(((((((.((((...((((((....(((...)))...))))))............)))).)))))))((((..........((((.((((((((((.(((((((((((((((((.(((((((((.((((((((((.....(((.......)))..)))))...(((((((((.....((((.(((((((.(((.....((.(.................).)))))...))))))).))))....))))))))).........))))))))((((.((((...(((((......)))))..(((....))).)))).)))))))))))))))))).))))))).(((((((....((((((.(((((.(((.(((((..((......)).((((.(((((.(((.((((.(((.((((((.....)).)))).))).))))((......))..((...)).))).)))))))))))))).))).)))))..(((..(((((........)))))..)))........(((((..(((((................))))).))))).))))))..((((.(((((((..(((....((((((..((((..................(((((......((((((((((..((((((((((((((((....((((((((..((((((.......((.((((.((....)).)))).)))))))).........(((((((((((..(((((....(((....((.((((..((((((...............))))))..)))))).....)))..))))).....)))))))))))....(((.....)))..((((((((...............)))))))).......((((..((((((.(((.(((((...(((((((....((......))....)))))))..........)))))..))).)))).)).)))).......))))))))(((..((((((......))).....)))....)))(((((((....((..((..((((((.(((.(.(((((.((((.....))))..))))).).)))..))))))))..))))))))).............))))).)))))))))))..))..)))).))))..(((((....((((((......))))))..)))))..))))).............(((..(((...((((((((.(..(((((....)))))..)))))))))..)))..)))..........))))..))))))...(((((((((((..((......))..)))).))....)))))........)))..))))))).)))).)))))))......)).)))))))))).))))...(((((((.(((((((((((.......))))))..((((..(((((((((((((.......)))))...))).....((((........))))........(((....)))...)))))..))))(((((((.(((((........))))).((((((.(((((.....(((.(((...............))).))).......)))))...........))))))...))))))))))))))))))).))))(((((((((((((((.((...)).)))))......)))))))))).(((((((.((((((.....((.((.(((((.(((((((.(((.....))).)...))))))..(((........)))(((((((((((.((((....))))))))...)))..))))...........(((((((((..(((((((.(.......................).)))))))..).)))))))).....((((((((.........))))))))........))))).)))).)))))))))))))..........)))))........((((((.....(((((...........(((((.(((((..(((((((((((((.......((..(((((((((.......((((.((((((((...((..((((((((.(((((((......(((((((..........((((((((.((((((((..........)))))))).)))))..)))(((((((...)))))))........((((((...(((((((((((((.....((.((((((...((((....)))).......(((((((((((((((((((...))))))))))...............(((((((((((((((((((((..((......))....))))))))).(((((((((......)))).)))))((((((.((((.....)))).))))))(((((((.......(((((((((...(((((........)))))(((.(((((.(((.((.(((...))).))))).))))).))).....(((.((((((((((((((((....)).......(((((((......)))))))((((((..(((((.(((((...((((.(((.......((((((..(((((.((((....)))))))))))))))......((((((((((((((....(((((....)))))))))))))......))))))....((((.((..(((((((...((......................((((((...))))))......(((((((((((.((((.............((((.((..........)).))))))))))).....))))))))......((((.......))))))...)))))))..)).)))).((((((.(((...((((...))))...)))))))))..))).))))......(((..(((((.................)))))..)))....)))))..)))))..)))))).((((((................))))))((((..(((((((((((.((........)).)))))))))))..))))......................(((((....)))))))))))))...............((((((((((...........))))))))))...))))))))).((((((...)))))).....((((((((....))))))))..))))))))).......)))))))....)))))))))))).((((((((((.....((......))...))))))).)))...)))))))))....................)))))).)).(((((((.....((((.((..((....)).)).)))).....)))))))(((((((...)))))))(((((.((......))..)))))...))))))...)))))))...))))))))))))).((((((.((((((((((((((((.....(((((.((((((((....(((..(((((.....(((..(((((..(......)..))))).(((.(((((..((((......((.(((((.(((....)))))))).))..))))..).)))).)))))).(((((......))))).....)))))..)))...)).)))))).....)).)))...))))).))).))))).))).)))))).((((((.(((((((..((((((((((....))).)))....))))..)))))))...))))))...(((...((((((....))))))....)))......(((((((.((((((((.....))).....((((....))))...((((((((((.(((..(((.((.................)).)))...))).))))))))))..........))))).)))))))...)))))..)).))))))))..)).(((.(((......)))..)))........((((.(((.((((..(......)..))))))).))))...........((((((((..(((((((...)))).)))...))).)))))))))).))).)))).((((........))))..........((((.(.(((...(((((.(((((....(((((((.......)))))))...))))).)))))...))).).))))..)))))))))..)).......))))))))(((.....))).....(((((((.(((.....))).))))))).)))))))))).)))))..))))).....)))))).....))))).......
Thermodynamic Ensemble Prediction
.((((.(((((.{.{{{.{{.,,||||||{((,.((.((((.{....,.)))),||...,,|||..|||,||{.{|||||||||}}{|{{{.{{{({{{{{{{,...,}}}}}|||{{{,,{,..{(((((((((({,,,{{,,(((({.,,((({{{{((|{{{,{{,({(,{(|({|.||}|}}.}},,,(((({{{{{{(({(({{{{,{{{{.{({((((((......||.|{{,,|((({{.,.{{{{{{,(((((.((({(((({{.(.(((.(.(((({{..{,,.....)).)))))))).}.)))),.)))))))})))}..))),)))).)),)).|||,,{{(({(((((,((,(((((({{.,,.,,.}}}))})).)),)))))))))).))),)))))).)).})))}....(.((((((((((...(((((((.....))))).))..)))))))))).}(({((((....)))).}}}.,,...}))))))..((.(((((((((.........)))))))))))(((((((((.(.(((...((((..(((((..((((...)))).)))))..)))))))},))))))))).(((((((.((((...((((((....(({...}))...))))))............}))).)))))))}}},...,||,,...||}}||||||||{{,(((((((((((((((((.((((((..({((((((((,,,,.{{((,..,,{{.,,,..,,,,,...(((((((((.,...((((.(((((((.(((.{...{,..{{.......,........,),)))...))))))).))))....)))))))))..}}},...)))),)).,|||}||||}}}(((((......)))))..(({..{{|,,.,)))}))),)))))))))))))).))))))).|||{{{{...,|||,|..|||||}|||,(((({...((({..((((.{((.{((((..(((((...}))))..)))).,.,))..)))}.}))))}|||}..{{.,,..}}..,)),)},.|||}},,,))}))),))),))}))}}|,,..(((((........))))).,{{{{.,,....(((((..(((((....,......,....))))).))))).,}},,)}}}|{,.{|||||{.,||{....(((((({{((({{{,{({{......,....{{{{{....,,(((({{{{((..((((((((({{,(((,.(((((((((.,,.((((({......,((.((((.((....)).)))).)))))))).........(((((((((((,.(((((....{((..,.((.((((..((((({...........,,..))))))..)))))),..,.)))..))))).....)))))))))))....(((.,,..}}}.,||,((((,.....,},,...,..)))))))))...,,,,,,,.,|||{{|,|||}{,|||}}|{((((((....((......))....))))))|{{{{{{{{{{|||||{{|||.||,|{|,.||||{...,{{(((,....{{{{{({((,....,,,|||..,..{{,,,,{{,.{,,,{|,,.,.||..{{,}|||||{.(((.(.(((((.((((.....))))..))))).).))){{||||||||,{|||||||}}.,||....,}...}}}}|{|||}}}))))),.||,.}}}},}}},..|||||....((((,({{{...}}||||.,|,}}}..,}},}}},,||,..,,,.,{{..,||,,.,|||||||},}}||{{{....|||||,.,|||}}},,..,||{{|||{,........,,,...,,||||,{...,,}}||{{((((....)))}...{{{|{......,,)))))......,,,..))}},||{|||{{||||,,|{{{,..||{|,||,|||||(({{(((,{{....}))})))},||||.,.,}}.)))),}}}}}....,|||,{((((((({{{{{{{,||||{|{|||||,..,}|||{|,|{|||||{{{,,....(((....))}...(((((((....))}}))))((((({.....,.))))),(((({(,(((((.,,..,{(((((........,,.,}}}}..,||{,,,|...}}}},...{{{{{{..|||{||,..((({{.{({|....).))))))))(((((((((((((((.({...}}.)))))......)))))))))){(((((,,.,...,,.}}}}||.,,{((,,{.,(((((..,.,..,{...,.}}..},.,,)}}}},}...}}}..,(((...,,))}.}}.}))))..))))))}..{||.....}}|,......,,.(((((((((..(((((((.{.........,,............).)))))))..).)))))))).....{|||||||........,)))))))),}},,,}))})))))})},|||||(({|||||........}}})),,.}}}||..,{{{{{..,,,{{{{|,,......,{{{{{{{.,{{||,.,,|,{{{||||,|},},,,,}|}}|||||..,,.,|||.,,{{{{,{{{{,..((((((....)))))){(((((((.(((.{((((((..........{(((((((.((((((((.,,,...,}.)))))))).))))}..))}(((((({...}))))))........((((((...(((((((((((((.....({.((((({...((((....)))).......(((((((((((((((((({...}))))))))),..............(((((((((((((((((((((..((......))....)))))))))}|((((((({......}})},})))}{{((({.{{{{,...})))).}}}}}}{((((((.......(((((((((...,((((........))))|(((.(((((.(((.((.(({...})).))))).))))).))),....(((.((((((((((((((({....}}.......,{(((((......)))))}|((((((..(((((.(((((...((((.(((.......((((({..{(((,{((((....)))))))))))))))...,.|{{{{{,((((((((....(((({....))))))))))))),,,,..}},,}}},,|((((,{(..(((((((,..((.......,,,{.....,.....{{({{....}))))),.....{(((((((({,,({{{.............((((.((..........)).))))}})}},.....)))))))))......((((.......)))))).,.))))))).,)}.)))),((((((.(((...((((...))))...))))))))},|)}}.})))......(((..(((((,.,|,.......,....)))))..)))....)))))..)))))..))))))}|{((({......,,,,.,,...,,,,,{((((..(((((((((((.((........)).)))))))))))..))))}...............,,,,..{({{{....))))})))))))}...............((((((((((...........))))))))))...))))))))).{(((({...,))))).....((((((((....))))))))..))))))))).......))))))}....,})))))))))).((((((((((..,,.((......)).,,)))))))}}))...}))))))))....,.......,.......}))))).}}.(((((((.,...((((.((..({....)).)).))))...,.)))))))(((((((...))))))){((((.((......))..)))))...))))))...)))))))...))))))))))))}))).)))))))|((((,{{(((((....)))))..))})))}...,,((({.(,.....,.)))}.,(((((..{......}..))))).(((.(((({..((((...,..((.(((((.(((....)))))))).)).,))))..}.)))).)))({|{..|{,,((,((((((..{((.((((.....))))))})))))).|}.,|},}{||||}}||||}}||||||}}}}}{(((((((((((((.(((.{{(({{({,((({{{....||||||}.,.|}))}...,,{{{{,.{{{{{|,,,|{{{...,)))}}})))).,||...,.}},..,,....,}}.))).))))))))))))))}..,.((((...,|}}|{..{(((((((((.(((..(((.((,,......,,.......)).))}...))).)))))))))},,{{{{.{,,,,,,},,,,)))))))))}}}.}}}))}}}}}}}..|}}|||.(((......))).||||{{......,|||,||,.,,{,.,|,,......}))))))).}}},.,....{{{..((((((((..(((((((...)))).)))...)))}})))).))}...........{(((........)))}...,,))))))}}}))))))))))}}..,,,}},}}}}|||{|||}......||||}}|,..((((((...))))))})))}}))))})))}.}})},,,)}},,...))))))},(((.....))).....||}}}|}}}}}}}},.,,,.}))))},.))|}}}|})}}}}})||||,,,.,,,,.)))),,.................

Transcripts

ID Sequence Length GC content
GUCCUACAGGUAUGGAUCUCUGGCAGCUGCUGUUGACCUUGGCACUGGC… 4312 nt 0.3917
Showing 11 to 11 of 11 entries
Summary

This gene encodes a member of the type I cytokine receptor family, which is a transmembrane receptor for growth hormone. Binding of growth hormone to the receptor leads to receptor dimerization and the activation of an intra- and intercellular signal transduction pathway leading to growth. Mutations in this gene have been associated with Laron syndrome, also known as the growth hormone insensitivity syndrome (GHIS), a disorder characterized by short stature. In humans and rabbits, but not rodents, growth hormone binding protein (GHBP) is generated by proteolytic cleavage of the extracellular ligand-binding domain from the mature growth hormone receptor protein. Multiple alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jun 2011]

Forensic Context

A study in rats demonstrated that the GHR exhibited significantly altered expression in liver tissue on day 7 following a 20% total body surface area burn injury [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025].