| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGUAAAAGCAAAAGCAACAGCUCAAGCAGCCUCCUUGGAGAAAACCU… | 1214 nt | 0.4077 |
This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. [provided by RefSeq, Jul 2008]
A study in humans and rats demonstrated that the GIMAP7 is a diagnostic biomarker for myocardial infarction, as it was one of six hub genes used to build a diagnostic nomogram showing high accuracy (AUC of 0.978 in training and 0.9 in validation sets) [Wei et al. DOI:10.3389/fimmu.2022.1061800]. Further research in humans, mice, and rats confirmed its role as a clinical diagnostic biomarker for acute myocardial infarction, where it was significantly downregulated in AMI myocardial tissue and showed a negative correlation with most immune cells [Li et al. DOI:10.1038/s41598-025-94820-6].