Basic Information

Symbol
GJA1
RNA class
mRNA
Alias
Gap Junction Protein Alpha 1 CX43 GJAL Gap Junction Protein, Alpha 1, 43kDa Gap Junction 43 KDa Heart Protein Gap Junction Alpha-1 Protein Connexin-43 SDTY3 ODOD ODDD ODD Gap Junction Protein, Alpha 1, 43kDa (Connexin 43) Oculodentodigital Dysplasia (Syndactyly Type III) Gap Junction Protein, Alpha-Like Connexin 43 AVSD3 EKVP3 HLHS1 PPKCA CMDR EKVP Cx43 HSS
Location (GRCh38)
6:121435577-121449727
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Sudden cardiac death diagnosis
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_000165.5
Sequence length
3083.0 nt
GC content
0.4045

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-837.50 kcal/mol
Thermodynamic ensemble
Free energy: -899.37 kcal/mol
Frequency: 0.0000
Diversity: 962.64
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((...(((.....(((((((((.(((((((((((((((((((.((((...((.((...(((((((((.((((........((((.((.((((((((..(((....(((.(((((.((.......((((...(((((((......)).))))).))))...((((((((((......))))))))))((((.......)))).....((((.(((...)))...))))((((..((((....))))..)))).))..))))).)))....)))..)))).)))).))))))...)))).))))))))).))))((((((((((.(((((....((((((((((((((((.....(((((........)))))..(((((.((((.((((......))))....)))).)))))..(((.((((.....(((((...((((((((....)).)))))))))))..(((((...(((.(((((((((...))))))).))...))))))))...............(((......)))..((((.....))))....(((((......))))))))).))).))))))(((((.......(((((.((.((.(((((....(((((((((((.........(((((((((.((((.((.......))..))))))))))))).(((((((((.((.(((((...(((((((((((((.(((.....))))))).)))))..(((((.......)))))......))))...)))))..))..)))))))))((((..(((((.(((((((.(((...((((((..(((.......)))..))))))...))).)))..((((.(((((((...(((.(((...))).))).....))))))).)....)))...))))..)))))..))))...)))))))))))...))))).)).)))))))(((((........))))))))))......))))))))))...))))))))......)))))))..)))).))))).....)))))))).((((((((((..((.(((((((((((((((........(((((((((((.((..((.(((.(((.......)))..)))..(((((.((((((((....((....((((...(((((.........((((..(((((((.(((.(((((...((.((((((.(((..(((((.(((((((.......((((((((.(((((.......((((........))))....((...(((......)))...))..)))))))))))))..(((((.(((.(((.(((((............))))(((((.....)))))..(((((......)))))..........(((((..........)))))............).))).))).)))))..........(((((((....))))))).................)))))))..)).)))))).)))))).))..))))).).)).)))).)))..)))).....(((((((.(.((((.(((((.....((((((((((......................))).)))))))...)))))...)))).).)))))))...))))).....))))...))...))))))))..)))))....))..)).))))))))))).........)))))))....((((((((.........((..((((((.......))))))..))...(((((.(((((((((......((.(((.(((((.......)))))))))).......(((((((.........((((((.((.(((..((((...))))...))).)).)))))))))))))..(((((((((......(((((((((.(((....((((.......))))...)))...))))))))).......(((....))).........((((((((((.((((.((((((..................................................(((((((((((((((.(((.(((((((..((((.......)))).(((.(((((.......(((.((((((((((((((..((((...))))(((((((...............((((((......((((((...((((((..((((((.((....)).))))))..))))))..)))))).(((((((((.......((((.....)))))))))))))............(((.((.(((((((((((((......).)))))))))))).)).)))((((......))))..))))))...............))))))).))))))).((((((......)))))).((..((((.....))))..))..........((((......)))).((((((....))))))(((((((((..(((((........)))))...((((((.(....).))))))...)))))))))(((....)))))))))))))..)))))..))).......))))))).))).)).)))))))))))))...(((((((((.(((..(((.(((((((((..((((....))))...))))).))))......(((((((((......))))))))).((((....(((((((........)))))))...))))))).))).)))))))))..)))))).).))).))))))))))..)))))))))..........................))))))))).))))).)))))))).....................(((((.((((((..((((...((((...))))..))))..)))))))).)))..)))).))))..))..))).))))))).))))))...........(((((((((...)))))))))...(((((((((((((......)).)).))))).))))........((((........))))))))))))).....)))...)))))))).................
Thermodynamic Ensemble Prediction
.((((((((...(((..,..((((((((((,,,{.,,{||{(((({((({{{((,..,,.||...((((((,,((((,,........|{{,.{{.(((({,(({{{,,,,,|||,,|||,,,,............,,.,(((({({{|...,|.||,||{{|,.{..((((((((((......)))))))))|(((({....}.))))},...||,|}|||..,)}}.,,))))||}...{(({....))))}}))..))))))||}|{{{(({{.|||{{|,,,.,,,,.{{{|||{{{||,|,|,||||{|(.,..)}|||||,||{,|{{,,..}}||||||||||}}}||}}}}}}{{{({...,,{{{|||}}.(((((({,...,(((,{{{{{{||,...((((({.(((((((((..,((({.{{{(((((...((((({((,...}),))))))))))}..(((((...{{(.(((((((({...})))))).))...,)})))))...,{.....||...{((...{{{|||{{((((((..,,,.{{{{{(({{({{.{{{},,.,|))},})}.|||||||{,({.,{{{{,(((({{((.((.(((((....(((((((((((.,.......((((((((,{((((.((.......))..))))))))))))).(((((((({.{({,(((({.{((..(((((((((.,((.....)},)))),}))))..)}|{||......}}}}},},..,}}}....|}}}}}}}.}}))))))))){{((,,(((((.(((({{{,({(,..(((({{..(((,,,,...,}}..)))))),..}})}))}||{|{(.(((((((...(((.(({...,)).})).....))))))).)}...,)),..))))..}))))..}))},.,)))))))))))...))))).)).))))))),{{,,...,,.{{|||||{|||{,,{{{{|,,,}}}}},..,|||||{.....{{{|,||||{{{|{{{{{||||.{{{.|||,,,,)}|,|||,||,,{((.{((,,,,}||,|}}..,{{{,(((((({({.,,.......{{..{(.,,,..}}....(((.(((......))).))).......,,...,|,||}}}|||||},|{{(({(((,,.{(,(((((((((...,....,....(((((.(((..(((((.(((((((....{{.((((((((.(((((.......((((........))))....((...{({......)))...))..))))))))))))),,(((((.(((.(((.{(((({.,..{,...,,|||}(((((.....))))).,(((((......))))),.........{{{{|,,,,...,,.})}))}}|,........,.))).))).))))).{,..{{...(((((((....)))))))..},..,,.........)))))))..)).)))))).))))))))))))))))))))))))))}))))).{((((...(((((((.(.((((.(((((.....((((((({{{.....,,{{..,,......,..)))})))))))...)))))...}))}.).))))))).))))){{{.{{{{,||...,,..}},,,})))}.))),...}}))}},}})),..,)))))}}.}||}||}))|,,{{{{{((((.,,((({{,.,..((((((((((.......))))))..||,,{{,,((((((((.....}}}}}}))|{{,|||{{,,.....|||}}}}},,...(((.(((((((.........((((((.((.(((..((({...}))).}.))).)).)))))))))))))..))}}}}}...,,,}}}|,|,})))))))}...{{{{.......)))).}))))))})),,,,.,,.......(((....)))..........}})}}},}},}}}}.}})}},.........,})))))}.,,.....{((((((..,(({,,,{,{{,,...(((((((((((({((.(((.(((((((,,{,,,{{{{{{.,,|,.||||||,,,,,.....{({{(((((((((((((({,{{((...}}}}.,,,.{{,{{{,.,({,,((((((((((,{{{{,((((((.,,((((((..((((((.((....)).))))))..))))))..)))))}.||||)))||.....,}))))))))})}|{(({....)))}}.........(((.({.(((((((((((((,...,})},,)))))))))).}).))),||.|||||..,.,,,|},,}},,,,,,........}}}},,,..}}}}|}}.((((((......)))))).||,.,}}}}}}.}}}}}}}}}},........{(((......}))}.((((((....)))))),,||||||,,,,,,,,......{{{{{{{...((((((.{....}.))))))...))))))),.{{{....}})))))))))}},.},.}})}},},}}}},,))))))).))).)).})))))))))))),|....,,,|,.{{{{|.{{{.(((((((((..((((....))))...))))).)))).}}}}}||{{(((((......}})))))})}}|||,,,...))))))}...|||}}}}}}}.))))}}.||.,,.,,,..,}}))},)))),)})})))}),,}))}}},},,}))))).)}}}}}}}}}}......,{.{{{.....))),}}},.,,,}|,||||||}},...|||,,||},........}||...||||||,}||||...,|||}}}))}},,}}}},,}))}}||{{{{{{{{|||{{|||,,,...|||||||}},...,,}}}}},........(((((((({...))))))))).,.{||{||||{{|||,.,...)),)),))}}}.}}}},,}}....{(({.,....,.))))))))))))).....)))...)))))))).................

Transcripts

ID Sequence Length GC content
NM_000165.5 NCBI
AAAAGCUUUUACGAGGUAUCAGCACUUUUCUUUCAUUAGGGGGAAGGCG… 3083 nt 0.4045
Summary

This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. The encoded protein is the major protein of gap junctions in the heart that are thought to have a crucial role in the synchronized contraction of the heart and in embryonic development. A related intronless pseudogene has been mapped to chromosome 5. Mutations in this gene have been associated with oculodentodigital dysplasia, autosomal recessive craniometaphyseal dysplasia and heart malformations. [provided by RefSeq, May 2014]

Forensic Context

A study in domestic swine demonstrated that the GJA1 gene, encoding a gap junction protein, exhibited further repression at the mature mRNA level compared to its nascent transcript in myocardial infarction, identifying it as an arrhythmia-related gene subject to post-transcriptional regulation [Kaikkonen et al. DOI:10.1161/CIRCGENETICS.117.001702]. In human arrhythmogenic cardiomyopathy, the GJA1 protein showed perturbed localization and reduced levels at the intercalated discs, correlating with pathogenic molecular remodeling [Chen et al. DOI:10.1161/CIRCRESAHA.114.302810]. A study in rats demonstrated that dephosphorylated connexin 43 is an early marker of myocardial ischemia, showing gap junctional expression with lateralization as early as 15 minutes after coronary artery ligation [Sabatasso et al. DOI:10.1007/S00414-016-1401-9]. In human autopsy cases, the rate of non-phosphorylated connexin 43 was significantly increased in both acute coronary syndrome and sudden cardiac death without coronary artery involvement compared to non-cardiac death controls, suggesting its utility as an indicator of rapid ischemic changes in the myocardium [Takeichi et al. DOI:10.1016/J.Legalmed.2025.102664].