Basic Information

Symbol
GJA5
RNA class
mRNA
Alias
Gap Junction Protein Alpha 5 CX40 Gap Junction Alpha-5 Protein Connexin 40 Gap Junction Protein, Alpha 5, 40kDa (Connexin 40) Gap Junction Protein, Alpha 5, 40kD (Connexin 40) Gap Junction Protein, Alpha 5, 40kDa Gap Junction Protein Alpha 5 40kDa Connexin-40 ATFB11 Cx40
Location (GRCh38)
Forensic tag(s)
Sudden unexpected death diagnosis Other applications

MANE select

Transcript ID
NM_181703.4
Sequence length
3177.0 nt
GC content
0.5036

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1100.00 kcal/mol
Thermodynamic ensemble
Free energy: -1156.16 kcal/mol
Frequency: 0.0000
Diversity: 1002.83
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.((.((((((.(((((((...((((((((.((((((..((...(((((((....((.(((((..(((((..(((..((((.(((..(((..(((.((((...((.((((((...(((((..(((((((((.((((((((...(((((((((((((((....))))..)))))))............(((.(((((((((...)))).)).))).)))..........))))...)))))).)).)))))))))(((((((((((((.((((((..((((((((((....((........))..))))))).)))....(((.(((((.......))))).)))....(((((..(((.(((.((.(((((.((.((((.......)))).))))))).....(((((.(((((......))))).)))))))))).)))..)))))(((....)))..((((((..((..(((.(((.((((((((((((((.(.......))))).)))))....((((((.(((....(((.((((((((..(((((((...((((((((..((((((((((..(((.(....(((....(((((((((.((..(((..((.(((((.....)))))))......(((((.(((............(((....))).(((...(((((.........))))).))).)))..))))).(((...((......))...)))((((((((((.(.((((....)))).)......(((((((((((((((.(((..(.((.(((..(((((((.((........)).)))))))))).)).)..)))...(((...........))).))))).))))))).)))(((((....)))))..))))))))))...)))..)))))))))))........((......)).)))...).)))...))))))))))..))))))))..)))))))..).......(((((((.............(((......))).............)))))))((((....))))((((((((((......(((((((..........).)))))).((((.((..(((.......))))).)))))))))))))).(((((((.((((((...((((((((........(((........))).(((((....))))).......(((.((((((....)))))).)))(((((..(.(((..((((((((.(((((((.(((........))).))))))..((((((.........).)))))......).))))))))..)))).)))))....))))))))))))))..(((....(((((..((((....)))).)))))...)))(((....)))...((((..(((..((((((.(...((((((((((.((...........((((((....)).)))))).))))))))))...).)))))).....)))....))))(((...))))))))))(((((((.((.....)).))))))).....))))))).))).....))).))))))........))))).))).)))..))..)))))))))))).)))))))(((.((((((((.(((((..((((((((.((.((((((.....((((.....)))))))))).))))))))))...)))...........((((((.((.((((.((((..(((...)))..))))))))...)).))))))((((((....)))))).)).))))))))...)))...))))))....((..((((..((((((((((...(((....)))..))))))))))...))))..))..........(((.(((.(((....((((((..((.(((((..((((((.((....))))))))..))))))).))))))....)))))))))..........)))))...)))))).)).)))).)))))).)))))))....))).)))))..))............)))))...))))))).((((((......))))))...((((..((.....))..))))........))..)))))).((((.(((.(((((((.((((..(((....((((((....))))))....(((((((((((((((((...........((((.......(((..(((.(...((((((.......)))))).).)))..))).......))))(((((......(((((........(((((((.(((((..(((((((((((((..(((...((((.(...(((((((((.((......(((.....)))...)).))))).))))))))).))).)))))))))).)))..))))).)))))))..)))))))))))))))))))))).......((((((((.(((((......)))))..(((.....)))....((((((((...((.(((((.(((.(((((((((((((((((((......))))...((.((((((((..(((((...(((((((......(((((.(((..(((((.....)))))...))).)))))...)))))))....)))))..............((((((......)))))))))))))).)).)))).)))).)))))))((((((((((......)))..(((((..(((((......)))))..))))))))))))))).))))).))))))))))....((((((.(((.((((..((((..((((((.((((((.((((..(((...((..((((((...))))))..))..))))))).))))))..)))......))).))))...)))))))))))))...((((((..(.((((((((.(((.(((((((((((.(((((.......((((((.((.(((......))).))((((((((...)))))).)))))))).......)))))))).....))))))))))))))).)))).)..)))))).........))))))))(((((...))))).).))))........))))))).))))))).))).))))........).)))))).)....))))))).......))).))).))))))..
Thermodynamic Ensemble Prediction
((({.(({((((,,.{{{(({,{{{((((((((,...{(((((({{{(,,,,........}|||.|}.||||}....,..,(((((((..({,..((({((({...(({((((((,..(({,,..|||,|})||}||||((({{..{({,(((((((((((....)))),,||||||},{,||{{,.{{|,..(((((((((((...((((((....,{((({({{...{(((.(({.(((.((((...)))))))))).)))}.....,}))))))),((((((((((....((........)),.)))))))},)))))))).))))))))))).{{((((({{.((({((((({{,,,.((({(..(((((.((.((((.......)))).)))))))....}||||,.,,|||,({{{{|||||{{|||,{(((((.{{{{{{.,.(((....))).{(((,,({{(,,{((({((,.(((,{,,,,{,|||}|}}}}}}.)),)).))))|{(((((({,,{((({...(((.{((,(((({{(((((((.{.((((((((..((((((((((..{{(.(,...{{{....(((((((((.{,,{(,,..((.(((((.....)))))}),,,.,,(((((,({(,,,.........(((....))),(((...(((((.........))))).)),.}}}..}}}},.{||.,,{{......)),..}})|||||||{{(|||((((....)))}.},.....(((((((((((((((.((({{,.((.(((..(((((((.((........)).)))))))))).)).)..,,)}}}|{{..,|,......))),))))).))))))),.}}(((((....))))),,})))))))))...},,}})})))))))))........,,......,,,))}...)}))}..,))))))))))..)))))))),.)))))))..|.......,{|||||}}}.},....,,,{,,.,,{{.||}.,.......},,}}))))||((((....))))||((((((((,,,,,,{(((({{,.....,,,,||||}}||,(((({(,..{((.,..,,.}}}||,|||}|||||}}}}.{((((,{,.(((,(({..,,,,,|||,},....|||||...,.,,))).(((((....)))))....,.}|||,|{((((....||||||,||{((,{,{(((((((((,.{(((({{((((((,(((......,.|||,}}))|,.,|,,,|||,|||,..|||||||.||,{{{|,|||||.,|{{|||.{||||,....)))|||}}}}},,...{{{,,..|{{{,..||{|},,,)}))})}}}),,})}.||||,,,.,{||,|{{{..(((..((((((.,...((((((((((.((....,......{||{{,...,),.}}}}},.))))))))))...}.))))))}}..,}},...}))))}})}}..}}))}))))|{(((({.{{.....}),))))))}.....}}}|},|{||,....,))),))))))..}}}}}}))))}.}}}.)))},)}..))))))||||||,}))),}}(({.((((((((.{{{{,..((((((((.((.((((((.....((((.....)))))))))).))))))))))...,||,....,}}..,((((((.((.((((.((((..(((...)))..))))))))..,)).))))))((((((....)))))).}}.))))))))...})),|}}}}}))}.......{{{{..((((((((((...(((....)))..)))))))))).,,)))}..,},...,}}},))}|}{{||{{|,,,,||||{|,,({,(((((..((((((.((....))))))))..))))))},|}||||{...|||....))}.}}}}}.,,))},,..})))),,,.))))))}))))))}))|{{{{{{.{{(({{.(({{{{|..,{{,......,.,,,..}}}}},.,.((((((......))))))...((((..((.....))..))))....{{{{{{..,||({{.,(((.{{{,{,,,,,{,{((({{.{{.{{{(,((({{{{(({{{(({,,...,((((((({(((,...||||......{,||,,..,{.{((..(((.,...((((({.......}))))).}.)))..))}.........,|(((((......(((((........(((((((.(((((..(((((((((((((..(((...,,{{.,,,,(((((((((.((..{...(((.....))),..)).))))).)))),}))).))).)))))))))).)))..))))).)))))))..))))))))))),((({{{|||{({.....,}|,|,,,.(((((......))))).(((..(((((({.,,.{,,,.|||..}))))))..)))..,,)))}}))),(((,,,||},..}}))))).....||,}}}})})),{||...,|,|}},})}).}},||})},,,,|)),.}}}}.,,)))}}})))})),,,})}}})),.)}))))),,,...............,)}}}}}))))))),)))))),,,,.,..})))))))..))))))))){{,,((((......))),.{({{{.,|{{{|,,...,))))),,))))),})))))}}},}|)))}))),},,}}}.,..(((({{{({{{((((..((((.,(({(({.((((((.((((..{((.|,((..((((((...))))))..)).,))))))).)))})),.))),,,}}}}}}.))))...)))))))))))))...,,,{{,..|}||||||||||((.(((((((((((.(((((...,...,({(({.((.{((......))}|),((((((({...)))))).))}}}}}}.......)))))))),....})))))))))|||||.}||},|,.|,}|||.......}}}}}}}}|,}}..,}}},.))))))),,)})......,{|||,.{||{||||{|,,{|||,,{,,((((......}}))),.})),))))..}}}}}))}.}))},.))))..

Transcripts

ID Sequence Length GC content
GACAGGCUCAAGAGCAAAAAGCGUGGGCAGUUGGAGAAGAAGCAGCCAG… 3173 nt 0.5052
GGUGAUACAGAAGAAAAGACAGUCUCCAUUUUCAAACAGUCCCUCCUGG… 3177 nt 0.5036
Summary

This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Mutations in this gene may be associated with atrial fibrillation. Alternatively spliced transcript variants encoding the same isoform have been described. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified a GJA5 c.286G>T (p.Ala96Ser) exonic missense variant in post-mortem cardiac tissues from sudden unexplained death in infancy (SUDI) victims, which was classified as likely pathogenic according to ACMG guidelines and results in decreased electrical coupling of gap junctions [Andersen et al. DOI:10.1007/s00414-019-02127-9]. In a separate study on human and rat corpus cavernosum, GJA5 was characterized as a marker for arterial endothelial cells, where in human tissue GJA5+ ECs accounted for the lowest proportion and were mainly distributed in the cavernous arteries region, while in rats Gja5 may not be a useful marker for venous and corpus cavernosum endothelial cells [Yin et al. DOI:10.1016/j.celrep.2024.114760]. A study in mice demonstrated that restoration of Connexin 40 correlated with the reversal of conduction anomalies in a myotonic dystrophy mouse model [Lee et al. DOI:10.1093/hmg/ddac108].