Basic Information

Symbol
GJB2
RNA class
mRNA
Alias
Gap Junction Protein Beta 2 NSRD1 CX26 Gap Junction Protein, Beta 2, 26kDa Gap Junction Beta-2 Protein Connexin 26 DFNA3 DFNB1 Gap Junction Protein, Beta 2, 26kDa (Connexin 26) Gap Junction Protein, Beta 2, 26kD (Connexin 26) Mutant Gap Junction Beta 2 Protein Mutant Gap Junction Protein Beta 2 Gap Junction Beta 2 Proteinc Connexin-26 DFNA3A DFNB1A BAPS Cx26 HID KID PPK
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_004004.6
Sequence length
2290.0 nt
GC content
0.4533

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-677.50 kcal/mol
Thermodynamic ensemble
Free energy: -721.43 kcal/mol
Frequency: 0.0000
Diversity: 650.59
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((....))))))..((...(((((.(((((((......((((.(((((((((.(.((......)).))))))(((((((((.((((...((((((((.(..((((..((((.((...(((...)))......(((((((((((((((((..((.((....((..(((((.(((((.((((.(((((..........((((.(((((((((((......))))))).)))).))))..........)))).).))))))))))))))..))....)).))..))))).))......))))))))))((((((((.((((((.......)))))).......((((((...)))))).((.((((...)))).))..........))))))))...))))))..)))).))))).))))..))))(((....)))..)))))))))((((((((....)))))).)).................))))..))))......)))))))....))))).......)).......((((((...........((((((((.....(((...)))...))))))))..(((((((..(((......((((((((((((((((((((...((((.((((.....))))))))...).))))))).....((((.((((((((........)))).)))))))).......(((((((((((((.((((.(((.....))).(((.(((((....))))).)))...((((..(((((((((..((((((...((.(((((.(((......))).)))))))...(((((..((((..(((((((((.........((((((((((........).)))))))))........((((((.((((.(((.((...)).)))...))))))))))..(((......))).).))))))))..))))....)))))......)))))).(((((((..((......))..)))))))....)))))))))..))))(((((...)))))......((((........)))).....((((.((((..(((....(((((((((....(((((((.((((((((....((((((..((((((..(((((((((((((......)))))))(((((((..((..((((((.((((.(((((((.......))))))).)))).(((.(((.((((((((((..(((...)))..))))))).)))))).))).......((((((..((((((((.((((...........((((((.......)))))).....)))).)))).))))..))))))...)))))).))..))))))).((((((...)))))).....(((((..(((.((((((((((........((.((((..(((...)))..)))).))....(((((((((((((((((..(((....(((...((.((((((((.....((((((.((((...)))).)))))).........((((((((...((((.((((((....)))))))))).)))))))).)))).)))).))....))))))))).)))))).......))))))))(((((......))))))))))))))).))))))))((((.....)))).((((((((.((((.((((.....)))).))))..))))))))..))))))......(((((....)))))(((((((......(((((((.((..(((((((((.....((((.((.....))..))))((((...(((....)))..))))........))))))..)))..)).)))))))........)))))))((((((((((((((..(((.((((.((((((((((((..........))).)))))))))..)))).)))))))))).))).))))..((((......)))))))))).))))))......)))).)))).......))))))).....))).))))))...)))...)))).))))...)))).)))))).)))))))))))).)).))))).(((.(((...(((.(((((((.((.......((((((.((((((((........))).)))))..))))))))...))))))).)))))).))).((((((((((..........))))).)))))...))).)))))))........(((((((..(((((((...)))))))..))).)))).......)))))).......
Thermodynamic Ensemble Prediction
((((((....))))))....((((((((((,,,,{{,...,)),((.(((.(((((.(.((......)).)))))).))).))},})))))....))))(((((....(((((.((((({(((.((((.((((((.......((((((((((((((((((..(((((((..........}}}.((((((((.((((((..((((.(((((((((((......))))))).)))).)))){,,.((({((({{,...(((((,(({((((((,.,.,{((,.(((((.{{{.(((((((..{{{(((({(((((((((.((((((.......)))))).,,,,.,((((((...)))))).|...|||}...,,}.,},...}}}},,)))))))}}}}}},((((...)))).))))))){,.(((({({({..,,,,,..,{(((..{{((((((....)))))).,}.)))),,,)),}..},.,),)),}.)),.})}.))))),)),))))))))}....}))))...{(((((((.........,.((((((((.....(((...)))...)))))))).,.........)))))))))}))))),,,}}}((((((({...((((.((((.....))))))))...).)))))))....))))))((((((((........)))).)))).)))))))}....))))..)))))))))))(((.....))).(((.(((((....))))).)))...,{{{,.(((((((((,,{((((({,.((.(((((.{{{.,,..,|}|,|}|||||,..{((((..((((..((((((((,.....{{{{((((((((({........)}}))))))))........((((((.((((.(((.({...}}.)))...))))))))))..|||}.....},,.}.))))))))..))))....))))|{{{,..,|{|,,{((,{,{,,{(({{{{..||{.{|,||,}....,)),)),)),.},,,(((((...)))))......((((,.......||||.,,....,,.||||{{({(({{{..(({......}})..}}},.,,,||||||,,|}}}},..,})))))).,)))))}|||||{({{((({{{{.,,(((((((..((..((((({.((((.(((((((.......))))))).)))).{((.{((.((((((((((..({,...}))..)))))))},))))).,)}....|,.((((((..((((((((.((((,{,,..,,|,.((((((.......))))))..,,,)))).)))).))))..))))))..,)))))).))..))))))).{{{{{,..,))))))...,,,,,,.}))}}}},|||,{{{{||},,,,.}||||||}}|||{{{|{{{{{{{{{{{.,,.(((,,{|||{||,,|||..,|,}}}}}|||||||||||{{{{|..|||{{{|||,{{{,...}}}},}}}|||{,,,{|{,,((((((((...((((.((((((....)))))))))).)))))))),{|||{,,,,,,))}..}}},..,|||}}||||....,,,})}}))}}||||(|||,,,|||||||||||{,,,,,||||,,,,||||,,,,{|||.|{{{{{((.((({.{(((.....,))}}))))..)))))))).........,,,..{{{||,.,,)))))}}|||,,,..}},,,|,,{(((((((((.(((.(....))))))).))))))...}}}|||||,,,},}))}}},,)))}},,,|,,|},},}}))},}}},,,,,,))))))).....)))))).)))).))).}..))))).).))))...((((((((((((.,,,.....,|}},,}|)))}}}......|{{{|||||{{|,,,..,,}.})))))))))|(((((((({({.(((.({...((((({,.{{{....,...,,,.....}}}.,}}}})}..,.}},))))))},..,....{(((((.((..(((((......)))))....)).)))))}((((({.,,,,,,,,,,}}}..,|,...}})))},,,,(((........))).))))))))|,,,,...((((.((((.{({.(((({..,(((((((((..........))))).))))))))).))}.))))))))..,,,|,.{(((,.(((((((...))))))),,))).,,,,........))))).......

Transcripts

ID Sequence Length GC content
GUUGCGGCCCCGCAGCGCCCGCGCGCUCCUCUCCCCGACUCGGAGCCCC… 2290 nt 0.4533
Summary

This gene encodes a member of the gap junction protein family. The gap junctions were first characterized by electron microscopy as regionally specialized structures on plasma membranes of contacting adherent cells. These structures were shown to consist of cell-to-cell channels that facilitate the transfer of ions and small molecules between cells. The gap junction proteins, also known as connexins, purified from fractions of enriched gap junctions from different tissues differ. According to sequence similarities at the nucleotide and amino acid levels, the gap junction proteins are divided into two categories, alpha and beta. Mutations in this gene are responsible for as much as 50% of pre-lingual, recessive deafness. [provided by RefSeq, Oct 2008]

Forensic Context

A study in rhesus macaques demonstrated that whole-thorax irradiation induced significant transcriptomic dysregulation in lung tissue, with the GJB2 identified as one of the top upregulated transcripts among common differentially expressed genes in irradiated animals, where its upregulation is associated with acute and chronic lung injury and epithelial-mesenchymal transition [Priyanka Thakur et al. DOI:10.1016/j.ijrobp.2021.03.058].