| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUGCGGCCCCGCAGCGCCCGCGCGCUCCUCUCCCCGACUCGGAGCCCC… | 2290 nt | 0.4533 |
This gene encodes a member of the gap junction protein family. The gap junctions were first characterized by electron microscopy as regionally specialized structures on plasma membranes of contacting adherent cells. These structures were shown to consist of cell-to-cell channels that facilitate the transfer of ions and small molecules between cells. The gap junction proteins, also known as connexins, purified from fractions of enriched gap junctions from different tissues differ. According to sequence similarities at the nucleotide and amino acid levels, the gap junction proteins are divided into two categories, alpha and beta. Mutations in this gene are responsible for as much as 50% of pre-lingual, recessive deafness. [provided by RefSeq, Oct 2008]
A study in rhesus macaques demonstrated that whole-thorax irradiation induced significant transcriptomic dysregulation in lung tissue, with the GJB2 identified as one of the top upregulated transcripts among common differentially expressed genes in irradiated animals, where its upregulation is associated with acute and chronic lung injury and epithelial-mesenchymal transition [Priyanka Thakur et al. DOI:10.1016/j.ijrobp.2021.03.058].