Basic Information

Symbol
GJC2
RNA class
mRNA
Alias
Gap Junction Protein Gamma 2 CX46.6 SPG44 GJA12 CX47 Gap Junction Protein, Gamma 2, 47kDa Gap Junction Alpha-12 Protein Gap Junction Gamma-2 Protein Connexin-46.6 Connexin-47 Gap Junction Protein, Alpha 12, 47kDa Connexin 47 LMPH1C LMPHM3 PMLDAR Cx46.6 HLD2 Cx47
Location (GRCh38)
Forensic tag(s)
Forensic psychiatry evaluation Drug abuse diagnoses

MANE select

Transcript ID
NM_020435.4
Sequence length
2165.0 nt
GC content
0.6841

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1116.80 kcal/mol
Thermodynamic ensemble
Free energy: -1149.49 kcal/mol
Frequency: 0.0000
Diversity: 560.95
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((.((((..((((((.((.(((((...(((((......(((((.(((((....(((....(((((..(((((((((((..(((((.(((((((((...((((((.....((((..(((((....(..(((((.((((((((((((((.......((((...((((((........)))))))))).((((((((((((...((.(((((..((((.((((((((..(((......((((((((.((.(((((.((.............(((((((...(((.((((...((((......))))...))))))).)))))))..((((((.(((((.....)))))..((((......))))((((..(((.....))).))))......)))))).)).))))).)).))))))))..((((.((((...))))))))))))))))))).))))..(((((((((((.((((((.((.(((((((.(((.(((((((((.(((...((((((......)))).))))).(((((...))))).((((((.(.(((.(((((.(.(((.(.(((((((.((....(((((.((((.((..(((((((.((..(((((((.((...((((((((...(((..(.((((....(((((((((((...((((.((.((((....)))).....((((.((....)).))))(((((((((((((......(((((..((.(((...((((((((((((((..........(((.((...(((.(.(((((.((((.....)))))))))).))).)).))).......)))))..)))))))))...))))))))))(((((((........))).)))).............)))))))))))))........)).)))).))))))).)))).((((((((((((..(((........)))..))).))))))))))))).)..))))))))))).)).)))).)))..))..))))))).))))))...))))))).))))))))))).).)))))))).)((((((((......))))).)))))))))....))))).))))))).))))))).).).)))))))))))).((.((((...))))))...((((((((((((.((((((.(....).)))))).))((((.(((((...((((......((((.....)))).))))))))))))).(((((((.((........)).)))))))..((((.(((((((..(((.......))).)).))))).))))))))))))))..((.......)).)))))..(((((((.(((...))))))))))......(((...)))..))))).))...)))))))))))))))))))))((((.((((((((...(((..((((..(((((((((..(((((.(((..(((...)))..))).))))))))))))))..)))).)))...)))))))).)))).(((((...)))))((((((((.(((..(((.(((((((...((((..((..((((((((((.((((((((.(((((((.((...))))))))).)))))).......(((......))).......))))))))))))..))....))))(.((((.((((((......)))))))))).))))))))........((((....))))))).)))..))))))))..)))))..)))))..)....)))))..))))(((((((.....))))))).))))))))))))).)).)).))).(.(((((((..(((...)))..))))))))))))))))))).((.((((((((((((((((..(((...)))..)))).))))))))...)))).)).))))))))..)))))...))))))))))))))).)))))))).(((((((..(((((((.(((..((((((.((((....))).).))))))))).)((((...)))).(((((((((.((...)).)))))))))...((((((...(((((.(((((....))))).))))).....))))))................)))))).))))))))))).))......((((......))))....
Thermodynamic Ensemble Prediction
..{{.((((..((((((.((.(((((...(((((......(((((.(((((....(((....((((({.(((((((((((,.(((((.(((((((((...((((((.....((((..(((((,,..{.,(((((,((((({((((((((.......((({..,((((((........)))))))}}}.,(((((((((((...((.(((((..((((.(((((((({.(((......((((((((.((.(((((.({......||.....(((((((...(((.((((...((((......))))...))))))).))))))).,({((({.(((((,...,)))))..((((......))))((((..(((.....))).))))..,,,,)))))}.}}.))))).)).))))))))..((((.((((...))))))))})))))))))).))))..{{(({(((((((((((((.((.(((((((.(((.(((((((((.(((..{(((({{....,}))),.)},}}.(((({...))))),|(({({.(.(((.(((((.(.(((.(.(((((((.((,,..(((((.((((.((..(((((((.((..(((((((.{(.{.((((((((...(((.{(.((((....(((((((((((...((((.((.((((....)))).....((((.((....)).))))(((((((((((((.,..{{((({(({(,{((({{{,({((,((((({{{,.......,.{{|}||}..||,},}|||||}||||.,}}.))))}}}}}},}||{||,|||{......}}}}|{,|||||||||...},},))}}})|||||,|}}}..}}.)))}))))...,,....,,..))))))))))))),.......)).)))).))))))).)))).((((((((({((,.{{{.|...,{,|}}..))),))))))))))))).},.))))))))))).)).))))}}))..))..))))))),)}))))...)))))}),))))))))))).).)))))))).)((((((({......|)))).)))))))),....))))).))))))),))))))).).).)))))))))))).||.{{{{...||||||...{{(((((({(((.((((((.(....).)))))).))|{({.(((({..,(({,..,.,|((((,,.{,||||{}||||||}}|||||(((((((.((........)).))))))){|(({{.||||{|{,|||||..,,,.}|}})},)))))}))),))))))}}))||||}}...}.}}.)))))}.(((((({,(((...))))))))))....,}|||..,))),}))))).))...)))))))))))}))))))))|((((.((((((((.,.(((..((((..{{(((((((,((((((.(((..(((...)))..))).)))))))))))))),.)))).)))...)))))))).)))),(((((...)))))({((({((,{((..{{|,||{{((({,.((((,.((..((((((((((..,((((((.(((((((.((...))))))))).))))))|,.....{{{|,....|||.....,}))))))))))))..))....)))){,((((.((((((......)))))))))).|||}||||,||..,,,||||.}}}))},})),))),.))))))))..})))),,))))),.),},.)))))..))))(((((((.....))))))).))))))}))))}),))})).))).|.(((((((..{((,..}}),,))))))),}))))))))))}((.((((((((((((((((..(((...)))..)))).))))))))...)))).)).))))))))..)))))...))))))))))))))).)))))))).(((((((..((((((,{(((..((((((.(.,({....}},},))))))}}}.,((((...)))).(((((((((.((...)).)))))))))...((((((...(((((.(((((....))))).))))).....))))))..............,.)))))).))))))))))).)}....,.((((......))))....

Transcripts

ID Sequence Length GC content
ACACACCCUCGGGGAGGACCAGCAUCCAAGCAGGUGGAAGGGCUCUGAG… 2165 nt 0.6841
Summary

This gene encodes a gap junction protein. Gap junction proteins are members of a large family of homologous connexins and comprise 4 transmembrane, 2 extracellular, and 3 cytoplasmic domains. This gene plays a key role in central myelination and is involved in peripheral myelination in humans. Defects in this gene are the cause of autosomal recessive Pelizaeus-Merzbacher-like disease-1. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the GJC2 is expressed in oligodendrocytes and its mRNA levels in human orbitofrontal white matter positively correlate with the microRNA miR-21, which is reduced in major depressive disorder and alcoholism [Miguel-Hidalgo et al. DOI:10.1016/J.Pnpbp.2017.08.009]. A systematic review of human postmortem studies found that the GJC2 mRNA is decreased in the anterior cingulate cortex of individuals who died by suicide [Yamamoto et al. DOI:10.3390/Ijms25115750].