Basic Information

Symbol
GMCL1
RNA class
mRNA
Alias
Germ Cell-Less 1, Spermatogenesis Associated SPATA29 BTBD13 GCL1 Spermatogenesis-Associated Protein 29 Spermatogenesis Associated 29 Germ Cell-Less Protein-Like 1 FLJ13057 GCL Germ Cell-Less, Spermatogenesis Associated 1 Germ Cell-Less Homolog 1 (Drosophila) Germ Cell-Less Homolog 1
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Drug abuse diagnoses

MANE select

Transcript ID
NM_178439.5
Sequence length
4161.0 nt
GC content
0.3864

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1161.90 kcal/mol
Thermodynamic ensemble
Free energy: -1247.05 kcal/mol
Frequency: 0.0000
Diversity: 947.65
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((.((((....)))).)))))..(((..(((((((((...(((((((.((((((...((.(((((((....(.((........)).)..))))))).))..))))))..))))))).......((((((((((((((.((((((((((((((((((((.((.(.(((......))).).)).))......))))))))))))(((((((....))))))).(((((.(((.(.(.((((((...(((((((.(.(((.(((((((....((.(((((.((((.((....)).))))...)))))))..)))).))).))).).))))...)))..)))))).).).))).))))).(((((((..(((((..(......)..))))))))))))..))))))...))))).)))))))))...(((((((((((.(.(((((((.((..(((((((..(((.(((....))).)))..).))))))..(((((((.....((((((((((((.......((((((((((((((((((.((((((((((..((((((((........)))((((((.........))))))..............((((((((((((((((....((((((((((((((((((((((((...))))).))).).)))))))......)))))))).....).)))))...))))))))))..)))))(((((...))))).)))))))).)))))))))))).))))))))..((((((((((((((((((...))))))))))))).(((((((.....(((((((.....(((((.(.(((((((.((.((((((((((((((........))))))(((((.......)))))..((((((..(((.....))).))))))...........(((......)))))))......)))).)).))))))).).)))))(((((((((((((((.((((.....(((......)))....))))))))...(((((((((((((((.....((((((.(((..(((.(.(((.(((......(((((((......(((((((.(((.(((......)))(((((((((....)))))).)))..(((....)))((((.....((((((((.(((((((((((((((.((((((((.(((((((((((((........))))).))))).)))))).....)))))((((.(((....((((((((((.((....)).)).)))))))).....))).)))))))))))))))))..)).))))))))....)))).((((((........))))))(((((((((....(((((.(((((((((.((..(((((......((..((((.((((...(((((((((((((.(((((.....((((((....))))))...)))))((((((((((((((.....(((.((((((((......((((...))))....))))...............(((..(((((((...)))...)))))))..((((((((((((..((((.((((((((..(((...........)))..))))))))((((((((((.....((((.....))))......))).)))))))...((((...(((((......)))))...))))(((((((.((..((((((((((....(((........)))....))))))))....))..))...)))))))........................((((((.......((((....(((((........)))))))))..((((((..................(((((............)))))))))))...(((.....)))))))))............))))....))))))).)))))........(((((..(((((((...((((((((....))))).))).))))))).)))))..))))))).....))))))).......((((...))))))))))).(((.(((((........))))).))).......((.(((((((((((.....))))))))))).))(((((.((.(((((........))))))).))))).))))))))))).))...)))))))).))...........((((((((((((.....)))))....)))))))((((((((((.(((((((.((((......)))))))))))....((((((.............))))))((((.(((..(((((((.((((..((((((.........(((((.......(((((.........))))).......)))))......))))))(((((((..(((.((((((((.(((.((.(..((((..................))))..).))..))))))))))).)))....))))))).((.((((.((.(((((((((((.(((((((((((......(((((((((((....))))(((......)))....((..((((((..((((((.((((((((((((((((.(((((((..((((.....)))).)))))))....(((.(((.((((((((((((((......(((((((..(.(((((((.(((((.(((((.......(((((((..(((((...........))))).))))))).....))))......).))))).))))))).)..))))))).....))))))))))))))))).)))))))))))))))))))((((........))))...(((((((((...))))))))).)))))).)))))).))...(((((((((((((....(((((((((((((....(((((((((...))).))))))....))))...)))))))))......)))))))))))))........(((((((......(((............((((.(((.......))).))))((((((.....(((((....))))).....))))))............)))......)))))))...............((((.((.......)).))))............)))))))........))))))))))).))))((((...(((....)))))))...........((((((((((.......((....))......)))))))))).........((((...(((((.(((((((((.((((((...(((.(((.....(((((......))))).....))).)))..))))))(((((((......(((((((((....)))))))))...))))))).))))))).)).))))).))))))))))).))))))))((((..........((((((.....))))))..........))))............................((((.((((.....)))))))).((((((((........)))))))).))))))))))).)))...))))..((..((((((.(((((((((........))))).)))).))))))..)).((((((((((((..........................(((((((((..((((.(((..........))).))))...)))))))))...(((((((....)))))))....)))))))).)))).((((......))))...((((((((((....))))))))))....((((((((.((((....))))))))))))..(((.(((((.......)))))..))).(((.((((....)))).)))((((((((...................)))))))))))))))))))))))...)).))))))))))))))))))))))).)))))))))).......)))))))))))))))))..))).))))))))))))))))))))).........)))))))))))...)))))))..))))))).....)))))......)))))))))))).))))))).))...))))))).).))))))).))))((((..((.((..((((((((....))))))))..)).)).))))...)))))))))...))).
Thermodynamic Ensemble Prediction
(((((.((((....)))).)))))..(((..(((((((((...(((((((.((((((...((.(((((((....(.((........)).)..))))))).))..))))))..))))))).,.,...((((((((((((((.(((((((((((((({{((((((({(({{{,}|||.}|}.,{|,(((...,}})}}})}}}}|||(((((((....)))))))}||{{{.{{{.{,|.{{{{{{...{{|{|||.|,|||,|||||||....{{.((((({((((.{{.,,,||.}})))},})))))),,)))).|||,}}}.),))))...}}}..}}))}).),).))),)})|}.{{(((({..(((((,,{...},.,..))))},)))))),.)))))),,.})))).)))))))))..{(((((((((((.(.(((((((.((..(((((((..(((.(((....))).)))..).))))))..(((((({.....((((((((((((....,,....{(((((((((((({{{{,,,{(({{,.{{{,{,{{.,{(((((((((((((((.........))))))..............((((((((((((((((....((((((((((((((((((((((((...})))),))},}.)))))))......)))))))).....).)))))...)))))))))).,{(((((..{{,.....{.((({(((((((((((((...))))))))}.{{{.{{{.(((((((((((({...}))))))))))))...)))))))},}}}}.}..,.,,|}.))))}||((((((((...(((((((((((((..((((((({((({(((((.......))))),,)}}}(((((((((,.(((((,..,(((((((..((((((...,..((((((((...,,.{((,{(({{.,,.,,|,,|||{{,.,{{,....}|,..,||||,,....|}}}}.},,..,{{{|||{{,|(((((.,{((,((((,{{.{|||(({,||||||,.,|,..||||},}},.}}.,))))}))),,}}..{(({((.(((((((({((..((..(((((((({....}))))).)))..)}.((((((((((......((((((((.(((((((((((((((,((((((((((({(((((((({(|....,|.}}))).))))).)))))).....)))))|{{{.{{{....((((((((((.((....)).)),,)))))))..,..}}).))),)))))))))))))..)).)))))))).,.....{{((({,{..,,,},.}}||},.|},....,....,,||(((((((((..((...........{(((((({{(((((((((,{,,{(((((((((.(((((((({{({((((..,.|}}}},...,,,,||{|(((,(((((((.,{..(((.((((({({......((({...}))}....}})}.........,,,...(((..(((({((...}}}...)))}))),.((((((((((((..((((.,(((((((..(((...........)))..)))))))|(((((((((({....((((.....))))....}.})),})))))),..{(((...(((((......)))))...)))|(((((((.((..((((((((((..,.(((........))).,..))))))))...,))..))...))))))),.............,.......,,((((((..,....((((....(((((.,....,.)))))))))..((((((.....,,,,.....,,,.(((((............)))))))))))...,{{....,,,.))))))............))))....))))))).))))),......,|{{{|..(((((((...{({(((((....))))).})).))))))).,,,},.})))))))..,,.))))))).,}}..,(((({,,,|},,|||}|},,,{.{((((........))))),))),}},,.{((.(((((((((((.....))))))))))).))}.,,,.{(,{{{{{........}))}},}.})))))))))..{((((({.(((.,(((((...(((.(((.{((...,((((((.((((((((..,{{,{(,.........})}}.)))))))).)))))).,...))}.))).)))...))))).,)...))).}))))))...)))}..,}))},}),.},..))))))))))))....))))}(((((.......(((((.........))))).......))))).(((((((.{.((((((((..(((.((((((((((((.((.{..((((..................))))..}.))..))))))))))).)))....)))))))).}...))))))}((((((((({,..{((({,{({{,...}}})}}|,,{{,...,|||||{{{{{.,((((({..,...{(((((..((((((.((((((((((((((((.(((((((.,(({{.....)))}.)))))))....(((.{(,{((((((((((((((......(((((((..{.(((((((.(((((,(,,..,|||||,,{(((({{{(((((,{,,........,,}}.,})))).,,.,}))))}},},,,.)))}}.))))))).}..))))))).....))))))))))))))))}.)))))))))))))))))))((((........|}}}...((((((({|...)}))))))).)))))).)))))},|{,..(((((((((((((....(((((((((((((....(((((((((...))).))))))....))))...)))))))))......)))))))))))))....}}}||{{(((({.{{{{(((...{{{({{({((({....}}}}..,}}.}}})})||||||.}}},(((((....))))).....}}}}}}|,,,.....,,..,{{{{{{{({{{.,|,,....,}..}}}}.})}}}))..,}}}}})},||{{{,...{{{{{.{((.,,(((((((.,{.........},.))))))).,,..))).))))},,...,........((((((((((.....,.({....))......))))))))))........{((((...(((((.(((((((((.((((((.{,{,{.(((,,...(((((......))))).....))),)))}.))))))(((((((......(((((((({....}))))))))...))))))).))))))).)).))))).)))))||||}}.}}}))})))))))))))))))){(((((.....))))))))..))))))))).,,.....................})))))))))(((({....,,|||||,.,(((((((.,....,.))))))))|}||.|..|}}}},....)})))))))).}||}||,||||}||(({(..{{{,,,.,}))))))),.,,,.,|,{,|.||||||,||}}.))))),...................)))))))),.)))))).))))))))))))).,.)}.)))))))))))))))...)))))),...})))))).))))))))}},|,,|,{{,.,...)}}}...((((((((((....))))))))))....(((((({{{((((....)))))))))))}..)))))))))},...}})))))}}))}}}}}}|,||,,.,||||{,,,{|,,..}}||}}}}}}......((((((({,(((((((((....((((......((((......)))).......)))))))))},))))))))))).,,,,..,||.||||,...},,,}},{({{({.((((((((........)))))))).)}.,})))..{(((((((((.,......)).))))))))..)))))))))))),))))))).))...))))))).).))))))).))))|{((..({.{(..((((((({....})))))))..)).}).))),...)))))))))...))).

Transcripts

ID Sequence Length GC content
GCUUUGUUGCGAAAGCGAGGGGGCGAGGUGCUGCGGUGCUAGAGCGCGG… 4161 nt 0.3864
Summary

This gene encodes a nuclear envelope protein that appears to be involved in spermatogenesis, either directly or by influencing genes that play a more direct role in the process. This multi-exon locus is the homolog of the mouse and drosophila germ cell-less gene but the human genome also contains a single-exon locus on chromosome 5 that contains an open reading frame capable of encoding a highly-related protein. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that γ-ray exposure up-regulated the GMCL1 gene, which is involved in differentiation, in liver tissue [Roudkenar et al. DOI:10.1269/jrr.07078]. A study in rats demonstrated that methamphetamine administration induced significant transcriptional changes in isolated microglia/macrophages, with the striatum showing more pronounced effects than the prefrontal cortex, particularly at 2 hours post-treatment [Kays et al. DOI:10.3390/brainsci9120340].