Basic Information

Symbol
GNA11
RNA class
mRNA
Alias
G Protein Subunit Alpha 11 FBH2 FHH2 FBH Guanine Nucleotide Binding Protein (G Protein), Alpha 11 (Gq Class) Guanine Nucleotide-Binding Protein G(Y) Subunit Alpha Guanine Nucleotide-Binding Protein Subunit Alpha-11 G Alpha-11 HHC2 Heterotrimeric Guanine Nucleotide-Binding Protein 1K Hypocalciuric Hypercalcemia 2 G-Protein Subunit Alpha-11 EC 3.6.5.- GNA-11 HYPOC2 HG1K GA11
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_002067.5
Sequence length
4190.0 nt
GC content
0.6291

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1897.00 kcal/mol
Thermodynamic ensemble
Free energy: -1971.22 kcal/mol
Frequency: 0.0000
Diversity: 1188.61
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((((.((((((((((.....(((((.(((((.....))))).))))))))))))))))))))...(((((((((((.(.....)))))))).))))(((((...((((...((((((.((((((.(((....)))..)))))).)..)))))))))))))).(((((((((((((..((((((((.(((.((((.(....).)))).)))..))))))))..)((((((((((((((((((((((((.((((((((((((((((((((((((((.(((((((.((((..((((..((((.((.(.(((.(((((.....((((..((((...((.(((....)))))..))))...))))....)))))))).)))))))........((((((((.(((((...(((....)))))))))).)))))).((((((......).)))))......))))....)))).))).)))).)))))).((((((..((((...(((((((((......((((((((...(((..(((((...((((((...((((........))))))))...))...)))))..)))...)).))))))......)))))...))))))))..)))))).....))))))).((((((....)))))).((..((.((.(.((((((((.(((((..(((((.((.((((((((((.((..((((.(.((.(.(((((((.((((((((.((((((((((((((((((.(((....((((.((((...((((((...(((.((..((((.....))))((((.((((......))))))))((((((..((((((((((.....(((((......)))))....((((......)))))))).)))))))))))))))))..))))))(((((((.(((......))).)))))))((((((((((......))))).)))))))))...))))....)))(((...))).)))))))))))))....))).....((((((((((((((......))))).((((((..............))))))......))))))))).((((((((((........))))......)))))).......)))))))))).))).)))).))))))))..)))))))..))))))).)))))..((.(((((((((((((.((((((((((((....)))).)))..)))))))))...(.((..(((...)))..)).).(((((((...(((.(.(((((((((........))))))))).).))))))))))....((((((((...(((...(((...))).....(((((((((......)))).)))))))).)))))))).........(((((...((((......)))))))))((((((.(((((((.((((((((((((((.((((((((((((.((((.((((((((.((...................((((...(((........)))..))))...((((.(((((............)))))))))..........)).))))))))....)))).))))........)))))))).)))))..)))..((((((((((.......................)).))))))))....................))))))..(((..(((((.....)))))...)))...(((((.((......))..)))))))))))).))))))..(((((((((((......((((((......))))))...........((.((((((......(((((((((.........(((((((..(....)..)))))))(((((....((.((((......(((....))).....)))).)).((((((((....((((((((((((..((((((((....((((.......(((....)))(((((((.((((.....)))).)))))))))))....)).....(((((.(((((...........))))).)))))...(((((.....)))))...((((((.(((((((((.((((((((.((((((....((((((((((((((...(((((...(((((((((((....))).))))))))(((((((((...(((((.(.(((((....))))).)..))))).))))))))).)))))....)))))(((((.(((.(((((((.......((.((.....)).)))))...)))).))).))))))))))))))...)))))).)...)))))))..)))).).......)))).))))))......(((((..(((((....)).)))..)))))))))))..)))))))))))).......(((....))).))))))))..))))).))))).))))((((((.((((((((......))).))))).)))))))))))).))..((((((((((.((...))...))))).)))))..((((((....))....))))..)))))))))))..(((.(((((.(((.(.((((((((.....)))))))).)))).))))).)))..((((.(.(((....)))..).)))).)))))).))).))....((((((((((....))))))))))..))))))))))))).).)).))..)).((((((((((((...))))).....)))))))..(((((((((..((((((.(((((((.(((((((..(((((((..........(((.((((((((((..(((((...((((((.((..(((....)))..)).)))))).......)))))..))))))..))).).)))...((((......)))))))))))..)))....)))).))))..........))).))))))...)))))))))..))))))))))))).))))).......)))))))))))..(.(((((((((((.((((..(((.(((((((((.....((((((((((((.(((..(((((.((((.((((....(((((((...((.((((((((((.(((.....(((((((.(((((..((.(((....))))))))))..)))))))........)))..))).))))))).)).........((((..(((((((((((...((((.((((.(((...((((((((.(((.(.((((((...)))))).)))).)))))).))...))).)))).))))((((.(((((.....(((((.....(((((((.((((((.((((.(((.........))).)))).)))))))).).))))..)))))....))))).).)))...)))))))..))))..))))(((((((((((.(((((((((......(((((((((((((((((.((((((.......)).)))).((.((((((((.(((.........))).)))))))).)))))))))...))).)))))))))))(((((((......((((((((.(((((..(..(((.(.(((((((....)))))))((.(((((((...(((((.(((((..(((((...)))))((((((..(((((((..((..((((((...(((((((((......))))).)))).))))))))..))))))).)))))).)))))....)))))...)).))))).)).).)))..))))))))))......))))......))).)))))))))))))))))..))).......))))))))))))))))))))..))).)).))).))))))).....)).))))))).))).))))))).)))))))).)))))))))...((((((...((((((......))))))...))))))((((((((..........(((((............(((....))).............)))))..........))))))))..((((((...))))))......(((((((.((.((((((......)))))).)).)))))))..)))))))))))))))).((((..((((...((((....))))....(((((.((........)).))))).))))..))))...(((((((...)))))))....
Thermodynamic Ensemble Prediction
.(((((((({{((((((((((....,(((((.(((((.....))))).)))))}))))))))}}||||||.{{|((({{{{(,{,....))))))))}})})|||||,.,|{((,..((((({,((((((.(((....)))..)))))),)..))))))))||||}|.(((((((((((({..((((((((.(((.((((.(....).)))).)))..))))))))..}((((((((((((((((((((((((.((((((((((({{(((((((((((((.(((((((.((((.,{{((,.,{{(.({{({((((((((({{..,{{||..{||{..}|,,(((....))}}}..||||,..,}}}....||||||||||||,|,|..,{{{..{(((((((.(((((...{((....)))))))))).)))))).{{|||,....,,),))))),}},.,)))},,,.)))).))).)))).)))))).((((((..((({..,(((((((((......((((((((...(((..(((((...(({{,(.{{((((........)))),)),},.))...)))))..)))...)).))))))......)))))...))))))))..)))))).....))))))).((((((....)))))){((.{((,((.(.((((((((.(((((..(((((.((.((((((((((.((..((((.{.{{.{.(((((((.(((((((({(({,,(((((((((((((.(.(((.,((,,(((.(.{(((((((.,.(((.((.,((((.....))))|(((.((((......)))))))}((((((..((((((((((.....(((((......)))))..,|((({......)))})))).))))))))))))))))).,)))))))|,||||,||{{{{{..,,).)))))},((((((((((......)))))))))))}((((.....))))....,,,..}))},)))))))))))))....{,|...,,((((((((((.((...,,..,|||{.((((((..............))))))).)},)))))))))).{{{{{{((((,.....},})))...,,,))||||.....,})))))))))).)))}}))).}}},))))..)))))))..))))))).)))))..((.(((((((((((((.((((((((((((....)))).)))..)))))))))...{.((..(({...}))..)).,.(((((((...(((.(.(((((((((........))))))))).).))))))))))....((((((((,.{(((..,{,,..,)}}}....(((((((((......))))}}})))|,}.)))))))).,.,,,{{{(((((...,{((......)))})))))((((((.((((({(,(((((((({{{{{{.(((((((((((({((({.((((({(((((......,,}}}}.......,,,,.,,{({........,,,..||||,..(((((.{......,,}))}}..}}},,,,..|||,.........,|.,,||{{,,.||||||||,..,,,...,}}})))),)))||,{|}},,((((((((((.......................)))))))))))...,,..,,,,.........,))))}..{{{..(((((.....)))))...}}).}.|||||,||......)),.)))))))))))).)))))}.,||||{|||||{....,,||||||..,,},)))))).........,|{{,((((({......(((((((((,,,,,,.,.{{{{{{,.......|{{||,|||{((.(({{{.((,,,,,..,,,.|,|}}},.))},.}},)))))..({((({{{|}|,((((((((((((..((((((,,...,{({,..|}.,,({{...,)))(((((((.((((.....)))).)))))))||||..|,}}},..,{,,,,...,,.......,,,,,|}}}},)))))}..(((((.....))))}.|.{{{{{{.{{{||((((.{{{{{{{,|||||||,..,(((((((((,{{{|.,,{{|||..,(((((((((((...,|||.|||||}}}|||||||||,..(((((.(,(((((....))))).),.))))).)))))))))})))}).,,,))))}{{{((.({(.{({({{{{{,|.|,||..{||...}}|||||....))))}))),))))))))))}}}),,,)))||}.,,}.))))|||,,}|||.|,.....}))))}})))))......{{(((..{{{{{..,,))}|}}..)))},))))))..)))))))))))}.......,|,....{{{{,|||,,,,}}).)))}))))).))))((((((.((((((((......))).))))).)))))),}}}}}.}},.((((((((((.({...}}...))))).)))))..((((({....))....))))..)))))))))))..(((.(((((.(((.(.((((((((.....)))))))).)))).))))).)))..((((.{.(((,...))).,}.)))).)))))).))).))....((((((((((....))))))))))..))))))))))))).).,,,),.,))}||{|||{(((((...))))).,{{{|||||||{{((((,{(((({((((((.,((,,(((((((((({{((((({,...,,,....(((.((((((((((..(((((...(((((({,({,({{....))),,,).)))))).,.....)))))..))))))..))).).)))...((((......)))),})})))}})),}}})),,)},,))}}},,,}}},,)).))),,,...,,,))))))})))))))))))))).)))))...,,..)))))))))))..{.(((((((((((.(((((,{((.(((((((((.....((((((((((((.(((..(((((.((((.{{((,{{.((((({{,......(((((((,({((({{{..(((((((.(((((..((.(((...,))))})))))..))))))).....{{{|||...||,,}))))).|..........||||.,(({|,,,||||..},)))))))}})}))}}((((((((.(((,{.((((((...)))))).)))).)))))).))...|(((((({(((({(.(,(((((({.{(,{(((,,{{{.,,,,.||}|{(((({(((({((,.,{{{,...)))})|||{|||||||{{|,||||.,.,|||{.{{|||||{{{{||,..|||||,...))))),)),)}},|||||||,}|||,,{{{||..,,,,||||||||||,|||||{(((((((.({...||{,|||{(({((((((((.(((.{......}))).))))))))...)))))))..}),},))})),)))))})))))}}......,,|}})).}}}}}}.}).))))).,|,||||}}}},,,))))||{((((({{...((((((((({(.,(((((...)))))((((((..(((((((..({..((((((...(((((((((......)))))))})).))))))))..))))))).)))))).|},..,))}}}}}}.,,||..,,))})}.|,}}}.,}}})}}})))}.....,||...{,{{{{{.|||.,,.)))))))))}.,}))...,,,.))})))))})))))))))))..))).)).))).))))))).....)).))))))).)))}))))))).)))))))),})))))))),,,((((((...((((((......))))))...))))))..|||,,,.....,,..,,{{{{.....||.....{||,,..,,,......(((.,,,,,.}}}.,,,,....,,}}}}}||{{{{{,,.,,)))}))}}}}}.{((((((.((.((((((......)))))).)).))))))}..))))))))))))),))}|,,,.,{{||,,.|{{{|||.}})),,..{((((.((........)).))))}.,}}}..,,,....(((((({...}))))))....

Transcripts

ID Sequence Length GC content
AGGUUGUCCGGCGCUGUCGCUCGGUUGCGGCGGCUGCGGUUGGCGGUGG… 4190 nt 0.6291
Summary

The protein encoded by this gene belongs to the family of guanine nucleotide-binding proteins (G proteins), which function as modulators or transducers in various transmembrane signaling systems. G proteins are composed of 3 units: alpha, beta and gamma. This gene encodes one of the alpha subunits (subunit alpha-11). Mutations in this gene have been associated with hypocalciuric hypercalcemia type II (HHC2) and hypocalcemia dominant 2 (HYPOC2). Patients with HHC2 and HYPOC2 exhibit decreased or increased sensitivity, respectively, to changes in extracellular calcium concentrations. [provided by RefSeq, Dec 2013] CIViC Summary for GNA11 Gene

Forensic Context

A study in humans identified the GNA11 as a significant differentially expressed gene in the nucleus accumbens of individuals with alcohol use disorder [Willis et al. DOI:10.1038/S41380-024-02777-1].